troponin C type 1 (slow) (TNNC1) - downstream reference sequence


            .         .         .         .         .         . g.8007
gcta / tctggctctggtgtccctgggccgtggactcatccccaggacccactcttacccaa c.*240

         .         .         .         .         .         .    g.8067
tggccgcttccttccctgtcctaggcaggctggctgcagagcctggcgcctgaccaccgc    c.*300

         .         .         .         .         .         .    g.8127
tccacactgccttctgcaggggggtgagatgagatcggagactgccgtgtggcctgccct    c.*360

         .         .         .         .         .         .    g.8187
gcttgctgccctctatcactcctcaggcccaggcaccatctctagggattcagcatctgg    c.*420

         .         .         .         .         .         .    g.8247
agtctgtgggggcctagaacccccacaagttcctgggggccatcactttggtcaaccact    c.*480

         .         .         .         .         .         .    g.8307
gtggcagcctaggggtcctctacttggagagagtggttcactgtggtacacagccaggcc    c.*540

         .         .         .         .         .         .    g.8367
cttggatgctccctggcacagcaacccctgttacctctcagccgtggctggaatggagct    c.*600

         .         .         .         .         .         .    g.8427
gagcctgtggggtccctgcaggctcacagtgctagtccacccgcccacttgcttgtattt    c.*660

         .         .         .         .         .         .    g.8487
cctgccagcaacattgactcccagggacagaggggcatggagtcggctctatctcccctc    c.*720

         .         .         .         .         .         .    g.8547
acctgtttggcccagagaggtgcagggacctgtcaaggtcatccagtgagtgtgggggag    c.*780

         .         .         .         .         .         .    g.8607
agcagagccaactggcttccagccaagggccctgtcggatgggccacatccaaatggaca    c.*840

         .         .         .         .         .         .    g.8667
tgatttccagttcccgtgaacctcagaggctcatctcttgtggcccagtctctctccctg    c.*900

         .         .         .         .         .         .    g.8727
gcagggatggaggcccaaggcctggcagctctcagcttagtgggagcacccagtccagag    c.*960

         .         .         .         .         .         .    g.8787
ctgccgccagacagtgatgctgtcttggaggcgtgggcgttgggggctgcaaggaagtgg    c.*1020

         .         .         .         .         .         .    g.8847
aagtgtcagcagaggtgttcgcaggagggacagctgccagcagcacccaggctgtagcca    c.*1080

         .         .         .         .         .         .    g.8907
gaatgccgtcagctgaccttgccccgcccagccactccactctctctgcacctgtgcccc    c.*1140

         .         .         .         .         .         .    g.8967
agccttggcattccccagacaggcctggcattccagagatggtcttggaattctaaaaat    c.*1200

         .         .         .         .         .         .    g.9027
gcctctgatggaggccagcgctagcaagagctttctggtccctggagagacctgagggga    c.*1260

         .         .         .         .         .         .    g.9087
gcagagaggagtcccttcaggcctgcccttgtgagctggagaattggggacctctacaga    c.*1320

         .         .         .         .         .         .    g.9147
cacccagagtgacccaggaagggtgacatccgaggataaaaggaagcgccacatcgggca    c.*1380

         .         .         .         .         .         .    g.9207
gcaccagcagccggtgcaccacccagtggttcactcacacacccaccacgcgcacagcac    c.*1440

         .         .         .         .         .         .    g.9267
agggctggatcctggggcatgtcacagtgaggcccagtccctaatctggtggattttttt    c.*1500

         .         .         .         .         .         .    g.9327
tttctttttttttgagacggagtctcactctgtcacccaggctggagtgcagtggtgcga    c.*1560

         .         .         .         .         .         .    g.9387
tctcagctcactgcaagctctgcctcccagattcacgccattctcctgcctcagcctcct    c.*1620

         .         .         .         .         .         .    g.9447
gagtagctgggactacaggcgcccgccaccacacccagctaattttttgtatttttacta    c.*1680

         .         .         .         .         .         .    g.9507
gagatggggtttcaccgtgttagccaggatggtctcaatctcctgacctcgtgatccacc    c.*1740

         .         .         .         .         .         .    g.9567
tgcctcggccttccaaagtgctaggattacaggcgtgagccaccgcgcccggcctttttc    c.*1800

         .         .         .         .         .         .    g.9627
tttttttgagacagagtctcgctgtgtcaccagactggagcgcagtggcacaatctcggc    c.*1860

         .         .         .         .         .         .    g.9687
tcactgtaacccctgcctcccaggttcaagcgatcctcgtgcctcagccacccaagtagc    c.*1920

         .         .         .         .         .         .    g.9747
tgggattacaggcacctgccaccacacccggctaatatttgtatttttagtagagacaag    c.*1980

         .         .         .         .         .         .    g.9807
gtttcaccatgtttcccaggctagacttgacctcctgagctcaagtgattcgcccacctt    c.*2040

         .         .         .         .         .         .    g.9867
ggcctcccgaagtgctgggattacaggtgtgagccaccgtgcccggcctaatctggtgga    c.*2100

         .         .         .         .         .         .    g.9927
attttaaggagatgagtacagtgggaaagccagcgtgggctggagtggggactggaggca    c.*2160

         .         .                                            g.9952
tggtgggcccatgagttacagtggt                                       c.*2185


Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center