troponin C type 1 (slow) (TNNC1) - 1478 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5110
gtgagggacagggctgggtagggctggggtgggcaggcccactgggggctcactcagctg  c.24+60

         .         .         .         .         .         .  g.5170
agagtgcggggttagtagccccagggaagtggtggggaccaaggagaaggcctacgtgcc  c.24+120

         .         .         .         .         .         .  g.5230
ttcaacccaggccctcacagggacagtgattctggtgtttgaggatgcagaaggggtagg  c.24+180

         .         .         .         .         .         .  g.5290
gggttccgggtctgaagggtggtggaggaggttgcagctttcagcatcgtgtctcactct  c.24+240

         .         .         .         .         .         .  g.5350
ctgtttccaagtgtctgtggtctgtggcactgtcgctcagccacatgtctctgcatttgt  c.24+300

         .         .         .         .         .         .  g.5410
ctctggacgtttttgcctttctcttttcatctcttcctcctgagctgtctgagtccccat  c.24+360

         .         .         .         .         .         .  g.5470
tactgtctccctgtccccaacccccatttctgcccctcacattctgcttctcacatgctc  c.24+420

         .         .         .         .         .         .  g.5530
aaaatctgccaccccactccagccccttggcgggccgaagatgctttggagggtggaggg  c.24+480

         .         .         .         .         .         .  g.5590
tgtgagaggaggggtctgtagagcctgagtcctgggctggagatggggctttgaagtttg  c.24+540

         .         .         .         .         .         .  g.5650
aggcagggaagttctggacatgagggagaaccaaggaagaaggaacagagaactggggcc  c.24+600

         .         .         .         .         .         .  g.5710
ccagctcccatcatgcctggcaggctcagggctcagtggcttagctaggggtgagagcga  c.24+660

         .         .         .         .         .         .  g.5770
gggaatgagggctggagagtggtcaccccaagcccctgcaacctcctgggtcactgaggg  c.24+720

         .           g.5789
tcttcagatgctattctat  c.24+739

--------------------- middle of intron ---------------------
                               g.5790             .           g.5808
                               c.25-739  cctgggtggtggtgacctc  c.25-721

.         .         .         .         .         .           g.5868
ccccaaccccagagcaaggacatcctggcatggccagctgtccccaggggaacccctccc  c.25-661

.         .         .         .         .         .           g.5928
tcagcctccctcactcctgggcagggaagtgctatagccagctctgggggcacgcctgct  c.25-601

.         .         .         .         .         .           g.5988
tatcctgtgggagtccatggagccggggttgggacagccctccacccagtgcccatacaa  c.25-541

.         .         .         .         .         .           g.6048
ggcctggcggagttggggactaattttggcttctgaggcggcactagcaggccagggggc  c.25-481

.         .         .         .         .         .           g.6108
cagataacgctgccccaccccctgcatgccaaagtccccagaacaatcaccaggtttaac  c.25-421

.         .         .         .         .         .           g.6168
tttgttcctcgttaaaaatagcccagtggccaccctggtcaggttaccgtgggtggcttg  c.25-361

.         .         .         .         .         .           g.6228
cctgcctccacactggttttattatcccaacttgagggacagctgtccttcgggccaccc  c.25-301

.         .         .         .         .         .           g.6288
agcttgagtttcatcaggggccgaaagggcattgagtggtcactgactattgttactgag  c.25-241

.         .         .         .         .         .           g.6348
ggtcaccttggtcctgaagggggtgcccacctgtcaccctggccctgagcccagtcgcag  c.25-181

.         .         .         .         .         .           g.6408
tgaggccagctgggtcacgtcagggctttgggggcagggagggaggactgagacctccac  c.25-121

.         .         .         .         .         .           g.6468
tctgtggcctggaaatagcctgcctcctccagctccagccttctcacctgtggaatgggt  c.25-61

.         .         .         .         .         .           g.6528
tggtttcctcagcagcagctatacctgagtctgagccttgagattccctttcctttctag  c.25-1


Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center