troponin C type 1 (slow) (TNNC1) - 230 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6619
gtgagaatccctatcacacatgtgggagaccagcgggtccaggctggcatggggacccct  c.55+60

         .         .         .         .         .       g.6674
tatcagaagaggaccccaggccagagaccagaggcttggtccctcttgctctgcc  c.55+115

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.6729
     ctcagagaggtctccgagggaggtgggcaggttggcaggtggccccagggttctg  c.56-61

.         .         .         .         .         .           g.6789
gccctccgtggtcctggctgctgagccctgactactgtgccccccaacccctgaacacag  c.56-1


Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center