troponin C type 1 (slow) (TNNC1) - 247 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6996
gtgagccccctcctccccaggctccagaagaaccccagctggctgggggctggaatgctg  c.202+60

         .         .         .         .         .         .  g.7056
gctctgtttagctgggagcaatttagcctatccgagccttggttgcctcatctataaaat  c.202+120

      g.7060
gggc  c.202+124

--------------------- middle of intron ---------------------
                                              g.7061          g.7063
                                              c.203-123  ata  c.203-121

.         .         .         .         .         .           g.7123
agggctacacaagcctggcgtttggtgtgaggatgcggtgagaacatgggggttcgtgtc  c.203-61

.         .         .         .         .         .           g.7183
gaaggtgctgcctgcagtacctaccctggcctctgtaacggccatgctgcccacccccag  c.203-1


Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center