troponin C type 1 (slow) (TNNC1) - 216 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.7358
gtgagcacgtgacccttgacctctgaccctgacccacactcaagccgagctgtacaggag  c.317+60

         .         .         .         .          g.7406
ggcagtctcagattccaggcctagggaccctgtggcctctgcctgata  c.317+108

--------------------- middle of intron ---------------------
 g.7407             .         .         .         .           g.7454
 c.318-108  ggggagagggatgccccatctcccagtgtccctgctctgcctcctggg  c.318-61

.         .         .         .         .         .           g.7514
gcatgggtggggctgcctcatgccctccccacagccctaccctgagccccctccccacag  c.318-1


Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center