troponin C type 1 (slow) (TNNC1) - 84 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .    g.7693
gtaagcgggtgggtgggctgatctcctgcctccatgccctgc  c.454+42

--------------------- middle of intron ---------------------
        g.7694      .         .         .         .           g.7735
        c.455-42  ccagcccctaccctcaacccacacctgcccctctttccacag  c.455-1


Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center