trafficking protein particle complex 2 (TRAPPC2) - coding DNA reference sequence

(used for variant description)

(last modified December 27, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_001011658.3 in the TRAPPC2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering TRAPPC2 transcript NM_001011658.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5032
                             acatcccagggtatcgcgagaactgcttcggc       c.-241

 .         .         .         .         .         .                g.5092
 gttctggctacaggttcggggcgcgggtctcttccgcggaaactgacattgcgtttccgt       c.-181

 .         .         | 02         .         .         .             g.5491
 tgtcggcctcccactgcag | tatcaccttctcccccaagtgtgacaaccaaagatgtctcc    c.-121

 .         .         .         .         .         .                g.5551
 agatattgccagatgtcctcttggaagcaagatcgctccgggttgagatccacagagcta       c.-61

 .         .         .         .         . | 03       .             g.19672
 aacgttttagagtaccaaccattgtgtgctgtgaggtaaag | gagccatatattgaagacc    c.-1

          .         .         .         .         .         .       g.19732
 ATGTCTGGGAGCTTCTACTTTGTAATTGTTGGCCACCATGATAATCCAGTTTTTGAAATG       c.60
 M  S  G  S  F  Y  F  V  I  V  G  H  H  D  N  P  V  F  E  M         p.20

          .         .         .    | 04    .         .         .    g.22984
 GAGTTTTTGCCAGCTGGGAAGGCAGAATCCAAA | GACGACCATCGTCATCTGAACCAGTTC    c.120
 E  F  L  P  A  G  K  A  E  S  K   | D  D  H  R  H  L  N  Q  F      p.40

          .         .         .         .         .         .       g.23044
 ATAGCTCATGCTGCTCTCGACCTCGTAGATGAGAACATGTGGCTATCGAACAACATGTAC       c.180
 I  A  H  A  A  L  D  L  V  D  E  N  M  W  L  S  N  N  M  Y         p.60

          .         .         .         .         .         | 05    g.23548
 TTGAAAACTGTGGACAAGTTCAACGAGTGGTTTGTGTCGGCATTTGTCACTGCGGGGC | AT    c.240
 L  K  T  V  D  K  F  N  E  W  F  V  S  A  F  V  T  A  G  H |       p.80

          .         .         .         .         .         .       g.23608
 ATGAGGTTTATTATGCTTCATGACATAAGACAAGAAGATGGAATAAAGAACTTCTTTACT       c.300
 M  R  F  I  M  L  H  D  I  R  Q  E  D  G  I  K  N  F  F  T         p.100

          .         .     | 06   .         .         .         .    g.25166
 GATGTTTATGATTTATATATAAAG | TTTTCAATGAATCCATTTTATGAACCCAATTCTCCT    c.360
 D  V  Y  D  L  Y  I  K   | F  S  M  N  P  F  Y  E  P  N  S  P      p.120

          .         .         .         .         .         .       g.25226
 ATTCGATCAAGTGCATTTGACAGAAAAGTTCAGTTTCTTGGGAAGAAACACCTTTTAAGC       c.420
 I  R  S  S  A  F  D  R  K  V  Q  F  L  G  K  K  H  L  L  S         p.140

                                                                    g.25229
 TGA                                                                c.423
 X                                                                  p.140

          .         .         .         .         .         .       g.25289
 atgcagaaaattccaaaataaatgatgtcaccacaatggtgtatactcaggaatgtgtac       c.*60

          .         .         .         .         .         .       g.25349
 attgtaagttacttgattaaatagcctggaaaacttttgtgtattctcagcttatctaaa       c.*120

          .         .         .         .         .         .       g.25409
 cctaatgaaattccttttatatttaaaaatagtacattctgtctcatgtcacgtatcaat       c.*180

          .         .         .         .         .         .       g.25469
 agatcaattggtatttccttgtgaacagtgttatttataaagagttcattatcaataatc       c.*240

          .         .         .         .         .         .       g.25529
 atgttttttttttttttttttttctgatacagagtctcactctgttgccaggctggagtg       c.*300

          .         .         .         .         .         .       g.25589
 cagtggcgcaatcttggctcactgcaacctccgcctcccaggttcaggcgattctcctgc       c.*360

          .         .         .         .         .         .       g.25649
 ctcagcctccaagtagctgggactacaggcgcgtgccaccacgcccggctaatttttgta       c.*420

          .         .         .         .         .         .       g.25709
 tttttagtagagacagggtttcaccatattggtcaggctggtcttgaactcctgacctcg       c.*480

          .         .         .         .         .         .       g.25769
 tgatctgcccgccttggcctcccaaagtactgggattacaggcgtgagccaccgtgccca       c.*540

          .         .         .         .         .         .       g.25829
 accatgaaatatttttacttaaaaattgggaataagctcgctttttttttttttgagatg       c.*600

          .         .         .         .         .         .       g.25889
 gagtcttgctcctgttgtgcaggctgtagtgcagtggcacgatcttggctcactgcaacc       c.*660

          .         .         .         .         .         .       g.25949
 tccacctcccgggttcaagcaattctccttcttcagcctcccgagtagctgagattatag       c.*720

          .         .         .         .         .         .       g.26009
 gcgtgcaccaccacacctggctaatttttgtatttttagtagagacagggtttcaccata       c.*780

          .         .         .         .         .         .       g.26069
 ttggtcaggctggtcttgaactcctgacctcgtgatccacccacctcaggaagtgctggg       c.*840

          .         .         .         .         .         .       g.26129
 attacaggcgtgtgagccaccacgcccggccatgaaatatttttacttaaaaattgggaa       c.*900

          .         .         .         .         .         .       g.26189
 taagctttttggttttttgtgggtttttgtttttgttttttgttttttgtttttttgaga       c.*960

          .         .         .         .         .         .       g.26249
 tggagtcttgctcctgttgtgcaggctggagtgcagtggcacagtcttggctcactgcaa       c.*1020

          .         .         .         .         .         .       g.26309
 cctccacctcctgggttcaagcaattctccttcttcagcctcccgagtagctgggattac       c.*1080

          .         .         .         .         .         .       g.26369
 aggcatgcaccaccacacctggctaatttttgtgtttttagtagagacggggtttcgcta       c.*1140

          .         .         .         .         .         .       g.26429
 ttttggccgggctggtttcaaactcctgacctcagttgatccacccgcctcagcctccca       c.*1200

          .         .         .         .         .         .       g.26489
 aagtgctaggattacaggcatgaaccaccgtgcccggccaggaataagcttttgacttac       c.*1260

          .         .         .         .         .         .       g.26549
 ccaattcagataggttgatctttggggttttttttttttttttgagatggagtttcgctc       c.*1320

          .         .         .         .         .         .       g.26609
 tgttgtccaggctggagtgcaatggcagttgtttcaccgtaacctctgcctcctgacttc       c.*1380

          .         .         .         .         .         .       g.26669
 aagcaattctcctgcctcagcctcccaaagtgctgggattacaggtgtgagccaccgtgc       c.*1440

          .         .         .         .         .         .       g.26729
 ccggcccagataggttgatcttaatgtaacaacccaaaaataaatgtcatagtcaagatt       c.*1500

          .         .         .         .         .         .       g.26789
 tggtagataaatttaaaattaaaatattctgcagttgggagtgaaatgtgatagcacata       c.*1560

          .         .         .         .         .         .       g.26849
 cgttgacattatgcatttagagatgttataaaaatgtataggcagtatacacagcactac       c.*1620

          .         .         .         .         .         .       g.26909
 tcaagaagccaaagaaacacttgtgcagtgctaagtgtcacatgtctgcttccaccagag       c.*1680

          .         .         .         .         .         .       g.26969
 gctaggaatagtgatcctgctataatgtgagaacccaaatcatgtttataaaataggacg       c.*1740

          .         .         .         .         .         .       g.27029
 ctgggagcagttgcaggccacagtgaagtgtgttgcttctgtcactttatattcttatat       c.*1800

          .         .         .         .         .         .       g.27089
 ttcctttccctcagacagtaaactgttgatactcgtacttgtaaaaaattgtaaggcaat       c.*1860

          .         .         .         .         .         .       g.27149
 ttttagtattgttgtcaaagaaaagcttggattacattaacatttgtattcagtctttta       c.*1920

          .         .         .         .         .         .       g.27209
 ggtgatacaccagagggggctgggaattgtctctttgttcctataagtagatcttaatgt       c.*1980

          .         .         .         .         .         .       g.27269
 aaaatagtaaatgtccattgaaaagcaagtaatacagcctgtgctaattgggagcacttg       c.*2040

          .         .         .         .         .         .       g.27329
 aacaattttgttccattctgagtaacttttgagcaagtaattctaagctttgtcttgtat       c.*2100

          .         .         .         .         .         .       g.27389
 ccttgtgtgaaattgcataatttttaccctatttgatttcttaaataaagatgtttgctc       c.*2160

                                                                    g.27394
 aagat                                                              c.*2165

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Trafficking protein particle complex 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.