triggering receptor expressed on myeloid cells 2 (TREM2) - coding DNA reference sequence

(used for variant description)

(last modified August 31, 2012)


This file was created to facilitate the description of sequence variants on transcript NM_018965.2 in the TREM2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering TREM2 transcript NM_018965.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5042
                   gcagcgcctgacatgcctgatcctctcttttctgcagttcaa       c.-61

 .         .         .         .         .         .                g.5102
 gggaaagacgagatcttgcacaaggcactctgcttctgcccttggctggggaagggtggc       c.-1

          .         .         .         . | 02       .         .    g.6591
 ATGGAGCCTCTCCGGCTGCTCATCTTACTCTTTGTCACAG | AGCTGTCCGGAGCCCACAAC    c.60
 M  E  P  L  R  L  L  I  L  L  F  V  T  E |   L  S  G  A  H  N      p.20

          .         .         .         .         .         .       g.6651
 ACCACAGTGTTCCAGGGCGTGGCGGGCCAGTCCCTGCAGGTGTCTTGCCCCTATGACTCC       c.120
 T  T  V  F  Q  G  V  A  G  Q  S  L  Q  V  S  C  P  Y  D  S         p.40

          .         .         .         .         .         .       g.6711
 ATGAAGCACTGGGGGAGGCGCAAGGCCTGGTGCCGCCAGCTGGGAGAGAAGGGCCCATGC       c.180
 M  K  H  W  G  R  R  K  A  W  C  R  Q  L  G  E  K  G  P  C         p.60

          .         .         .         .         .         .       g.6771
 CAGCGTGTGGTCAGCACGCACAACTTGTGGCTGCTGTCCTTCCTGAGGAGGTGGAATGGG       c.240
 Q  R  V  V  S  T  H  N  L  W  L  L  S  F  L  R  R  W  N  G         p.80

          .         .         .         .         .         .       g.6831
 AGCACAGCCATCACAGACGATACCCTGGGTGGCACTCTCACCATTACGCTGCGGAATCTA       c.300
 S  T  A  I  T  D  D  T  L  G  G  T  L  T  I  T  L  R  N  L         p.100

          .         .         .         .         .         .       g.6891
 CAACCCCATGATGCGGGTCTCTACCAGTGCCAGAGCCTCCATGGCAGTGAGGCTGACACC       c.360
 Q  P  H  D  A  G  L  Y  Q  C  Q  S  L  H  G  S  E  A  D  T         p.120

          .         .         .  | 03      .         .         .    g.8331
 CTCAGGAAGGTCCTGGTGGAGGTGCTGGCAG | ACCCCCTGGATCACCGGGATGCTGGAGAT    c.420
 L  R  K  V  L  V  E  V  L  A  D |   P  L  D  H  R  D  A  G  D      p.140

          .         .         .         .         .         .       g.8391
 CTCTGGTTCCCCGGGGAGTCTGAGAGCTTCGAGGATGCCCATGTGGAGCACAGCATCTCC       c.480
 L  W  F  P  G  E  S  E  S  F  E  D  A  H  V  E  H  S  I  S         p.160

    | 04     .         .         .         .         .         .    g.9176
 AG | GAGCCTCTTGGAAGGAGAAATCCCCTTCCCACCCACTTCCATCCTTCTCCTCCTGGCC    c.540
 R  |  S  L  L  E  G  E  I  P  F  P  P  T  S  I  L  L  L  L  A      p.180

          .         .         .         .         .         .       g.9236
 TGCATCTTTCTCATCAAGATTCTAGCAGCCAGCGCCCTCTGGGCTGCAGCCTGGCATGGA       c.600
 C  I  F  L  I  K  I  L  A  A  S  A  L  W  A  A  A  W  H  G         p.200

          .         .         .         .         .         .       g.9296
 CAGAAGCCAGGGACACATCCACCCAGTGAACTGGACTGTGGCCATGACCCAGGGTATCAG       c.660
 Q  K  P  G  T  H  P  P  S  E  L  D  C  G  H  D  P  G  Y  Q         p.220

          .       | 05 .         .                                  g.9448
 CTCCAAACTCTGCCAG | GGCTGAGAGACACGTGA                               c.693
 L  Q  T  L  P  G |   L  R  D  T  X                                 p.230

          .         .         .         .         .         .       g.9508
 aggaagatgatgggaggaaaagcccaggagaagtcccaccagggaccagcccagcctgca       c.*60

          .         .         .         .         .         .       g.9568
 tacttgccacttggccaccaggactccttgttctgctctggcaagagactactctgcctg       c.*120

          .         .         .         .         .         .       g.9628
 aacactgcttctcctggaccctggaagcagggactggttgagggagtggggaggtggtaa       c.*180

          .         .         .         .         .         .       g.9688
 gaacacctgacaacttctgaatattggacattttaaacacttacaaataaatccaagact       c.*240

          .                                                         g.9704
 gtcatatttagctgga                                                   c.*256

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Triggering receptor expressed on myeloid cells 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build beta-07
©2004-2012 Leiden University Medical Center