three prime repair exonuclease 1 (TREX1) - coding DNA reference sequence

(used for variant description)

(last modified August 4, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_033629.3 in the TREX1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009820.2, covering TREX1 transcript NM_033629.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5036
                         ccgatgtggaagaccccgaggtggagtgtggctgag       c.-781

 .         .         .         .         .         .                g.5096
 gccctgagtgtccagccacatggtggcaccagcaccactcctttccttaccacatcaact       c.-721

 .         .         .         .         .         .                g.5156
 gattaaagcagtgaccagcaggaactgcccagagaactggctggccttgtttcctgagtc       c.-661

 .         .         .         .         .         .                g.5216
 tgatctgtttggcggagtgggaggggtggagcaggacccggaccctgagtggctgggatc       c.-601

 .         .         .         .         .         .                g.5276
 cttcttcctgtccctggctgttgctgagcccgtccccatggtaactgatctgccttgagg       c.-541

 .         .         .         .         .         .                g.5336
 aaggagccctgccctgcctgtggaattgtcctgagtcattgctttgggctggggccatgg       c.-481

 .         .         .         .         .         .                g.5396
 gaagaaaccattgtgtggcagggaaggaggtggctcttggcccaggcctaaaccaggaaa       c.-421

 .         .         .         .         .         .                g.5456
 gcctgggaaactgggacccacaggtgggcatgaaagggccgcagcaggggctcccagcag       c.-361

 .         .         .         .         .         .                g.5516
 tgtgtaagaccgggagctggtctggcaccactgccctggtccttccagctgcctgtcact       c.-301

 .         .         .         .         .         .                g.5576
 ggtatgatggccccggtgcattgtgccaccagcaggccacagctgtggatcttggaaggc       c.-241

 .         .         .         .         .         .                g.5636
 ctctggggtcccccgggagcaggggagtgggtgtgggggggaacggatggtggtgagagg       c.-181

 .         .         .         .         .         .                g.5696
 gacagaccaggcaggctgacgagcagggcgggcctggctcacgtgggcctgtaggcgggc       c.-121

 .         .         .         .         .         .                g.5756
 ccacgccaagtttcacttcccgccactgctgccagcgagagccgcgggagagtgtgcagc       c.-61

 .         .         .         .    | 02    .         .             g.6136
 cgagtcactactgcctgcctgcctgcctgctacg | gctcagcagcaggtacgtacccaacc    c.-1

          .         .         .         .         .         .       g.6196
 ATGGGCTCGCAGGCCCTGCCCCCGGGGCCCATGCAGACCCTCATCTTTTTCGACATGGAG       c.60
 M  G  S  Q  A  L  P  P  G  P  M  Q  T  L  I  F  F  D  M  E         p.20

          .         .         .         .         .         .       g.6256
 GCCACTGGCTTGCCCTTCTCCCAGCCCAAGGTCACGGAGCTGTGCCTGCTGGCTGTCCAC       c.120
 A  T  G  L  P  F  S  Q  P  K  V  T  E  L  C  L  L  A  V  H         p.40

          .         .         .         .         .         .       g.6316
 AGATGTGCCCTGGAGAGCCCCCCCACCTCTCAGGGGCCACCTCCCACAGTTCCTCCACCA       c.180
 R  C  A  L  E  S  P  P  T  S  Q  G  P  P  P  T  V  P  P  P         p.60

          .         .         .         .         .         .       g.6376
 CCGCGTGTGGTAGACAAGCTCTCCCTGTGTGTGGCTCCGGGGAAGGCCTGCAGCCCTGCA       c.240
 P  R  V  V  D  K  L  S  L  C  V  A  P  G  K  A  C  S  P  A         p.80

          .         .         .         .         .         .       g.6436
 GCCAGCGAGATCACAGGTCTGAGCACAGCTGTGCTGGCAGCGCATGGGCGTCAATGTTTT       c.300
 A  S  E  I  T  G  L  S  T  A  V  L  A  A  H  G  R  Q  C  F         p.100

          .         .         .         .         .         .       g.6496
 GATGACAACCTGGCCAACCTGCTCCTAGCCTTCCTGCGGCGCCAGCCACAGCCCTGGTGC       c.360
 D  D  N  L  A  N  L  L  L  A  F  L  R  R  Q  P  Q  P  W  C         p.120

          .         .         .         .         .         .       g.6556
 CTGGTGGCACACAATGGTGACCGCTACGACTTCCCCCTGCTCCAAGCAGAGCTGGCTATG       c.420
 L  V  A  H  N  G  D  R  Y  D  F  P  L  L  Q  A  E  L  A  M         p.140

          .         .         .         .         .         .       g.6616
 CTGGGCCTCACCAGTGCTCTGGATGGTGCCTTCTGTGTGGATAGCATCACTGCGCTGAAG       c.480
 L  G  L  T  S  A  L  D  G  A  F  C  V  D  S  I  T  A  L  K         p.160

          .         .         .         .         .         .       g.6676
 GCCCTGGAGCGAGCAAGCAGCCCCTCAGAACACGGCCCAAGGAAGAGCTACAGCCTAGGC       c.540
 A  L  E  R  A  S  S  P  S  E  H  G  P  R  K  S  Y  S  L  G         p.180

          .         .         .         .         .         .       g.6736
 AGCATCTACACTCGCCTGTATGGGCAGTCCCCTCCAGACTCGCACACGGCTGAGGGTGAT       c.600
 S  I  Y  T  R  L  Y  G  Q  S  P  P  D  S  H  T  A  E  G  D         p.200

          .         .         .         .         .         .       g.6796
 GTCCTGGCCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGAT       c.660
 V  L  A  L  L  S  I  C  Q  W  R  P  Q  A  L  L  R  W  V  D         p.220

          .         .         .         .         .         .       g.6856
 GCTCACGCCAGGCCTTTCGGCACCATCAGGCCCATGTATGGGGTCACAGCCTCTGCTAGG       c.720
 A  H  A  R  P  F  G  T  I  R  P  M  Y  G  V  T  A  S  A  R         p.240

          .         .         .         .         .         .       g.6916
 ACCAAGCCAAGACCATCTGCTGTCACAACCACTGCACACCTGGCCACAACCAGGAACACT       c.780
 T  K  P  R  P  S  A  V  T  T  T  A  H  L  A  T  T  R  N  T         p.260

          .         .         .         .         .         .       g.6976
 AGTCCCAGCCTTGGAGAGAGCAGGGGTACCAAGGATCTTCCTCCAGTGAAGGACCCTGGA       c.840
 S  P  S  L  G  E  S  R  G  T  K  D  L  P  P  V  K  D  P  G         p.280

          .         .         .         .         .         .       g.7036
 GCCCTATCCAGGGAGGGGCTGCTGGCCCCACTGGGTCTGCTGGCCATCCTGACCTTGGCA       c.900
 A  L  S  R  E  G  L  L  A  P  L  G  L  L  A  I  L  T  L  A         p.300

          .         .         .         .                           g.7081
 GTAGCCACACTGTATGGACTATCCCTGGCCACACCTGGGGAGTAG                      c.945
 V  A  T  L  Y  G  L  S  L  A  T  P  G  E  X                        p.314

          .         .         .         .                           g.7126
 gccaagaaggaaaatctgacgaataaagacccccgctgccccata                      c.*45

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Three prime repair exonuclease 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19a
©2004-2017 Leiden University Medical Center