three prime repair exonuclease 2 (TREX2) - coding DNA reference sequence

(used for variant description)

(last modified September 19, 2012)

This file was created to facilitate the description of sequence variants on transcript NM_080701.3 in the TREX2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering TREX2 transcript NM_080701.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5004
                                                         cacc       c.-541

 .         .         .         .         .         .                g.5064
 ttggtcacactccagagctcgcttcatccccacgagcggcacctgatctccagtgacggg       c.-481

 .         .         .         .         .         .                g.5124
 gagactgaggcctggcaaagaggacctgttgcctttgtgtaactggccccagcatggggg       c.-421

 .         .         .         .         .         .                g.5184
 aggcattggccccagcatgggggaggcattgaccccaggcctgccaggcctggcagccac       c.-361

 .         .         .         .         .         .                g.5244
 agcctggctaggtggaggttactgccttccgcaccactctggcttcctccccgtgcctgt       c.-301

 .         .         .         .         .         .                g.5304
 gaagagctcggggcctgcttcctaatttgtaaacacggggcgtgtgtctcagtggctgtg       c.-241

 .         .         .         .         .         .                g.5364
 agctagcgagggggtggcgagcgagccggctgcgcaggtcctgaggccccaggcctcatt       c.-181

 .         .         .         .         .         .                g.5424
 gttggccaacaggcagctgggggcgggctgcggccgctgattaaaggccgcctagagcag       c.-121

 .         .         .         .         .         .     | 02       g.5997
 cctgtgtggcgacaggtgcccagaagcccaggaagccggtcagtgcccgccccag | tcctc    c.-61

 .         .         .         .         .         .                g.6057
 agggtttgtgcctctcgctcggacagtttgaggacttgctatccccgtgggaacatcacc       c.-1

          .         .         .         .         .         .       g.6117
 ATGTCCGAGGCACCCCGGGCCGAGACCTTTGTCTTCCTGGACCTGGAAGCCACTGGGCTC       c.60
 M  S  E  A  P  R  A  E  T  F  V  F  L  D  L  E  A  T  G  L         p.20

          .         .         .         .         .         .       g.6177
 CCCAGTGTGGAGCCCGAGATTGCCGAGCTGTCCCTCTTTGCTGTCCACCGCTCCTCCCTG       c.120
 P  S  V  E  P  E  I  A  E  L  S  L  F  A  V  H  R  S  S  L         p.40

          .         .         .         .         .         .       g.6237
 GAGAACCCGGAGCACGACGAGTCTGGTGCCCTAGTATTGCCCCGGGTCCTGGACAAGCTC       c.180
 E  N  P  E  H  D  E  S  G  A  L  V  L  P  R  V  L  D  K  L         p.60

          .         .         .         .         .         .       g.6297
 ACGCTGTGCATGTGCCCGGAGCGCCCCTTCACTGCCAAGGCCAGCGAGATCACCGGCCTG       c.240
 T  L  C  M  C  P  E  R  P  F  T  A  K  A  S  E  I  T  G  L         p.80

          .         .         .         .         .         .       g.6357
 AGCAGTGAGGGCCTGGCGCGATGCCGGAAGGCTGGCTTTGATGGCGCCGTGGTGCGGACG       c.300
 S  S  E  G  L  A  R  C  R  K  A  G  F  D  G  A  V  V  R  T         p.100

          .         .         .         .         .         .       g.6417
 CTGCAGGCCTTCCTGAGCCGCCAGGCAGGGCCCATCTGCCTTGTGGCCCACAATGGCTTT       c.360
 L  Q  A  F  L  S  R  Q  A  G  P  I  C  L  V  A  H  N  G  F         p.120

          .         .         .         .         .         .       g.6477
 GATTATGATTTCCCCCTGCTGTGTGCCGAGCTGCGGCGCCTGGGTGCCCGCCTGCCCCGG       c.420
 D  Y  D  F  P  L  L  C  A  E  L  R  R  L  G  A  R  L  P  R         p.140

          .         .         .         .         .         .       g.6537
 GACACTGTCTGCCTGGACACGCTGCCGGCCCTGCGGGGCCTGGACCGCGCCCACAGCCAC       c.480
 D  T  V  C  L  D  T  L  P  A  L  R  G  L  D  R  A  H  S  H         p.160

          .         .         .         .         .         .       g.6597
 GGCACCCGGGCCCGGGGCCGCCAGGGTTACAGCCTCGGCAGCCTCTTCCACCGCTACTTC       c.540
 G  T  R  A  R  G  R  Q  G  Y  S  L  G  S  L  F  H  R  Y  F         p.180

          .         .         .         .         .         .       g.6657
 CGGGCAGAGCCAAGCGCAGCCCACTCAGCCGAGGGCGACGTGCACACCCTGCTCCTGATC       c.600
 R  A  E  P  S  A  A  H  S  A  E  G  D  V  H  T  L  L  L  I         p.200

          .         .         .         .         .         .       g.6717
 TTCCTGCACCGCGCCGCAGAGCTGCTCGCCTGGGCCGATGAGCAGGCCCGTGGGTGGGCC       c.660
 F  L  H  R  A  A  E  L  L  A  W  A  D  E  Q  A  R  G  W  A         p.220

          .         .         .         .         .                 g.6768
 CACATCGAGCCCATGTACTTGCCGCCTGATGACCCCAGCCTGGAGGCCTGA                c.711
 H  I  E  P  M  Y  L  P  P  D  D  P  S  L  E  A  X                  p.236

 

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Three prime repair exonuclease 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.