tocopherol (alpha) transfer protein (TTPA) - coding DNA reference sequence

(used for variant description)

(last modified November 26, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_000370.3 in the TTPA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016123.1, covering TTPA transcript NM_000370.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5032
                             gggtagctgcggccgcagcagcggcggcgggc       c.-1

          .         .         .         .         .         .       g.5092
 ATGGCAGAGGCGCGATCCCAGCCCTCGGCGGGGCCGCAGCTCAACGCGCTACCGGACCAC       c.60
 M  A  E  A  R  S  Q  P  S  A  G  P  Q  L  N  A  L  P  D  H         p.20

          .         .         .         .         .         .       g.5152
 TCTCCGTTGCTGCAGCCGGGCCTGGCGGCGCTGCGGCGCCGGGCCCGGGAAGCTGGCGTC       c.120
 S  P  L  L  Q  P  G  L  A  A  L  R  R  R  A  R  E  A  G  V         p.40

          .         .         .         .         .         .       g.5212
 CCGCTCGCGCCGCTGCCGCTCACCGACTCCTTCCTGCTGCGGTTCCTGCGCGCCCGGGAT       c.180
 P  L  A  P  L  P  L  T  D  S  F  L  L  R  F  L  R  A  R  D         p.60

          .         .     | 02   .         .         .         .    g.18001
 TTCGATCTGGACCTGGCCTGGCGG | TTACTAAAAAACTATTATAAGTGGAGAGCAGAATGT    c.240
 F  D  L  D  L  A  W  R   | L  L  K  N  Y  Y  K  W  R  A  E  C      p.80

          .         .         .         .         .         .       g.18061
 CCAGAAATAAGTGCAGATCTACACCCTAGAAGTATTATTGGCCTCCTAAAGGCTGGCTAC       c.300
 P  E  I  S  A  D  L  H  P  R  S  I  I  G  L  L  K  A  G  Y         p.100

          .         .         .         .         .         | 03    g.24958
 CATGGAGTCCTGAGATCCAGGGATCCCACTGGCAGCAAAGTTCTTATTTACAGAATCG | CA    c.360
 H  G  V  L  R  S  R  D  P  T  G  S  K  V  L  I  Y  R  I  A |       p.120

          .         .         .         .         .         .       g.25018
 CACTGGGACCCCAAAGTTTTTACAGCTTATGACGTATTTCGAGTAAGTCTAATCACATCC       c.420
 H  W  D  P  K  V  F  T  A  Y  D  V  F  R  V  S  L  I  T  S         p.140

          .         .         .         .         .         .       g.25078
 GAGCTTATTGTACAGGAGGTAGAAACTCAGCGGAATGGAATCAAGGCTATCTTTGATCTG       c.480
 E  L  I  V  Q  E  V  E  T  Q  R  N  G  I  K  A  I  F  D  L         p.160

          .         .         .         .         .         .       g.25138
 GAAGGTTGGCAGTTTTCTCATGCTTTTCAAATCACTCCATCCGTAGCCAAGAAGATTGCT       c.540
 E  G  W  Q  F  S  H  A  F  Q  I  T  P  S  V  A  K  K  I  A         p.180

          .   | 04     .         .         .         .         .    g.26785
 GCTGTACTTACG | GATTCATTTCCATTGAAAGTTCGTGGCATCCATTTGATAAATGAACCA    c.600
 A  V  L  T   | D  S  F  P  L  K  V  R  G  I  H  L  I  N  E  P      p.200

          .         .         .         .         .         .       g.26845
 GTAATTTTCCATGCTGTCTTTTCCATGATCAAACCATTCCTGACTGAAAAAATTAAGGAA       c.660
 V  I  F  H  A  V  F  S  M  I  K  P  F  L  T  E  K  I  K  E         p.220

     | 05    .         .         .         .         .         .    g.29685
 CGG | ATTCACATGCATGGGAACAACTACAAACAAAGCTTGCTTCAGCATTTCCCAGACATT    c.720
 R   | I  H  M  H  G  N  N  Y  K  Q  S  L  L  Q  H  F  P  D  I      p.240

          .         .         .         .         .         .       g.29745
 CTTCCTCTGGAATATGGTGGTGAAGAATTCTCCATGGAGGACATTTGTCAGGAATGGACA       c.780
 L  P  L  E  Y  G  G  E  E  F  S  M  E  D  I  C  Q  E  W  T         p.260

          .         .         .         .         .                 g.29802
 AATTTTATAATGAAGTCTGAAGATTATCTCAGCAGCATTTCTGAGAGCATTCAATGA          c.837
 N  F  I  M  K  S  E  D  Y  L  S  S  I  S  E  S  I  Q  X            p.278

          .         .         .         .         .         .       g.29862
 gaagttatgtcatgtgaatggcttcctaactaaaaatacatgagtgatatccaacctggt       c.*60

          .         .         .         .         .         .       g.29922
 taaatgaatgaaagaaaaggagcaaatcttttaaactaatgcttgcctgaactttaaaaa       c.*120

          .         .         .         .         .         .       g.29982
 tgtagaaatcttctgacatgagcaacacaggtgtttggaaagattttttactttttaaat       c.*180

          .         .         .         .         .         .       g.30042
 gcttttttctctacttttgaagtaattaaatgtcagtacattttaagagcataaaaatcg       c.*240

          .         .         .         .         .         .       g.30102
 gcgattttgtacttgaagagaacatgaaagttattgctaaagtagctgctcatgtgcatc       c.*300

          .         .         .         .         .         .       g.30162
 tttgtatgtttctagaaagttatattttaaacaagttctctgattaaattggtttagaaa       c.*360

          .         .         .         .         .         .       g.30222
 aaaatttagaaatattccgcttaaaaatactagcacaagtcagctaatgataaaaaaatt       c.*420

          .         .         .         .         .         .       g.30282
 aacacttgttttaagtggatgtcagattaaattataattcattataattaaaatctgaat       c.*480

          .         .         .         .         .         .       g.30342
 agagttttatggttattcctgtggaccagcaagacatttcatctcagggaaattttattt       c.*540

          .         .         .         .         .         .       g.30402
 tagtatattaacacgatagaaactttttttttttttttcagacagagtcttgctctgtcg       c.*600

          .         .         .         .         .         .       g.30462
 cccaggctagagtgcagtagtgagatctcagctcactgcaacctctgctaggattacatg       c.*660

          .         .         .         .         .         .       g.30522
 tgcacaccaccactcctggctaagttttgtattttatatagagatggggttttgccacgt       c.*720

          .         .         .         .         .         .       g.30582
 tggccaagctggtctcaaactcctgaactcaagtaatttgcctgcttcggcctcccagag       c.*780

          .         .         .         .         .         .       g.30642
 tcctgggattacagtcgtgagccatcgcgcctggccgtgatagaaactttcagctgagga       c.*840

          .         .         .         .         .         .       g.30702
 gtctatatgccatactactctatgtggcatctttaggtctctgtgaaatcatgttgatgt       c.*900

          .         .         .         .         .         .       g.30762
 aattgattaacaaaaataatttagaaaatacgtcaggcacagttgatggcttctcaatat       c.*960

          .         .         .         .         .         .       g.30822
 ctgctttgcatttttaaacaaatcaagaatgtaattttaacttttgcttatggtcattct       c.*1020

          .         .         .         .         .         .       g.30882
 tatgactacacggaaagggatggaatcatacttacttgtcttatacatggactgttttta       c.*1080

          .         .         .         .         .         .       g.30942
 gttaacaataacgtaactacacaaaggaaaggaaatgtttacattttaaaaaattactgt       c.*1140

          .         .         .         .         .         .       g.31002
 caattacatctggtatttttcagattatgcataaaataatatgagtttgactattgtatc       c.*1200

          .         .         .         .         .         .       g.31062
 agaatattttaatcaaatcctgcaatttatattaacttaaaaaaacatctggtaaagact       c.*1260

          .         .         .         .         .         .       g.31122
 gggtgtggcagctcacacctgtaatcccagcactttgggaggccgaggctggatggatga       c.*1320

          .         .         .         .         .         .       g.31182
 ttgcttgagcgcaggagttctagaccagcctgggcaatacagggagaccctgtctctatt       c.*1380

          .         .         .         .         .         .       g.31242
 tcaaaaataaataaataggccccggtgtgtgatgttccccttcctgtgtccatgtgttct       c.*1440

          .         .         .         .         .         .       g.31302
 caaaaaaaattaaaaaataaaaataaaaataaataaataaataaccggtaaagatgtact       c.*1500

          .         .         .         .         .         .       g.31362
 gtttctactgcagtttataatatttcatttattaagaaagatatcatctcagctttcaaa       c.*1560

          .         .         .         .         .         .       g.31422
 ttcaacatagccctcaatttatgacataagttttatacttagtattttataatttcttaa       c.*1620

          .         .         .         .         .         .       g.31482
 ttttgttataaacttgaaaatgtagaatatggggtccaaaatctgttgaacatttgttca       c.*1680

          .         .         .         .         .         .       g.31542
 gctagttaggtttcaacattaatcatatacattaatagtatctttatgtaaggatatgtg       c.*1740

          .         .                                               g.31566
 aagggtgtttttctttataagaaa                                           c.*1764

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Tocopherol (alpha) transfer protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center