twist basic helix-loop-helix transcription factor 1 (TWIST1) - coding DNA reference sequence

(used for variant description)

(last modified September 17, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_000474.3 in the TWIST1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008114.1, covering TWIST1 transcript NM_000474.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5051
          gaggtataagagcctccaagtctgcagctctcgcccaactcccagacacct       c.-301

 .         .         .         .         .         .                g.5111
 cgcgggctctgcagcaccggcaccgtttccaggaggcctggcggggtgtgcgtccagccg       c.-241

 .         .         .         .         .         .                g.5171
 ttgggcgctttctttttggacctcggggccatccacaccgtcccctccccctcccgcctc       c.-181

 .         .         .         .         .         .                g.5231
 cctccccgcctcccccgcgcgccctccccgcggaggtccctcccgtccgtcctcctgctc       c.-121

 .         .         .         .         .         .                g.5291
 tctcctccgcgggccgcatcgcccgggccggcgccgcgcgcgggggaagctggcgggctg       c.-61

 .         .         .         .         .         .                g.5351
 aggcgccccgctcttctcctctgccccgggcccgcgaggccacgcgtcgccgctcgagag       c.-1

          .         .         .         .         .         .       g.5411
 ATGATGCAGGACGTGTCCAGCTCGCCAGTCTCGCCGGCCGACGACAGCCTGAGCAACAGC       c.60
 M  M  Q  D  V  S  S  S  P  V  S  P  A  D  D  S  L  S  N  S         p.20

          .         .         .         .         .         .       g.5471
 GAGGAAGAGCCAGACCGGCAGCAGCCGCCGAGCGGCAAGCGCGGGGGACGCAAGCGGCGC       c.120
 E  E  E  P  D  R  Q  Q  P  P  S  G  K  R  G  G  R  K  R  R         p.40

          .         .         .         .         .         .       g.5531
 AGCAGCAGGCGCAGCGCGGGCGGCGGCGCGGGGCCCGGCGGAGCCGCGGGTGGGGGCGTC       c.180
 S  S  R  R  S  A  G  G  G  A  G  P  G  G  A  A  G  G  G  V         p.60

          .         .         .         .         .         .       g.5591
 GGAGGCGGCGACGAGCCGGGCAGCCCGGCCCAGGGCAAGCGCGGCAAGAAGTCTGCGGGC       c.240
 G  G  G  D  E  P  G  S  P  A  Q  G  K  R  G  K  K  S  A  G         p.80

          .         .         .         .         .         .       g.5651
 TGTGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCAGCAGCAGCGGCGGCGGGAGTCCG       c.300
 C  G  G  G  G  G  A  G  G  G  G  G  S  S  S  G  G  G  S  P         p.100

          .         .         .         .         .         .       g.5711
 CAGTCTTACGAGGAGCTGCAGACGCAGCGGGTCATGGCCAACGTGCGGGAGCGCCAGCGC       c.360
 Q  S  Y  E  E  L  Q  T  Q  R  V  M  A  N  V  R  E  R  Q  R         p.120

          .         .         .         .         .         .       g.5771
 ACCCAGTCGCTGAACGAGGCGTTCGCCGCGCTGCGGAAGATCATCCCCACGCTGCCCTCG       c.420
 T  Q  S  L  N  E  A  F  A  A  L  R  K  I  I  P  T  L  P  S         p.140

          .         .         .         .         .         .       g.5831
 GACAAGCTGAGCAAGATTCAGACCCTCAAGCTGGCGGCCAGGTACATCGACTTCCTCTAC       c.480
 D  K  L  S  K  I  Q  T  L  K  L  A  A  R  Y  I  D  F  L  Y         p.160

          .         .         .         .         .         .       g.5891
 CAGGTCCTCCAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCTCAC       c.540
 Q  V  L  Q  S  D  E  L  D  S  K  M  A  S  C  S  Y  V  A  H         p.180

          .         .         .         .         .         .       g.5951
 GAGCGGCTCAGCTACGCCTTCTCGGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCG       c.600
 E  R  L  S  Y  A  F  S  V  W  R  M  E  G  A  W  S  M  S  A         p.200

                                                                g.5960
 TCCCACTAG |                                                       c.610
 S  H  X                                                         p.202

          .         .         .         .   | 02     .         .    g.6559
 caggcggagccccccaccccctcagcagggccggagacctag | atgtcattgtttccagag    c.*60

          .         .         .         .         .         .       g.6619
 aaggagaaaatggacagtctagagactctggagctggataactaaaaataaaaatatatg       c.*120

          .         .         .         .         .         .       g.6679
 ccaaagattttcttggaaattagaagagcaaaatccaaattcaaagaaacagggcgtggg       c.*180

          .         .         .         .         .         .       g.6739
 gcgcacttttaaaagagaaagcgagacaggcccgtggacagtgattcccagacgggcagc       c.*240

          .         .         .         .         .         .       g.6799
 ggcaccatcctcacacctctgcattctgatagaagtctgaacagttgtttgtgttttttt       c.*300

          .         .         .         .         .         .       g.6859
 tttttttttttttgacgaagaatgtttttatttttatttttttcatgcatgcattctcaa       c.*360

          .         .         .         .         .         .       g.6919
 gaggtcgtgccaatcagccactgaaaggaaaggcatcactatggactttctctattttaa       c.*420

          .         .         .         .         .         .       g.6979
 aatggtaacaatcagaggaactataagaacacctttagaaataaaaatactgggatcaaa       c.*480

          .         .         .         .         .         .       g.7039
 ctggcctgcaaaaccatagtcagttaattctttttttcatccttcctctgaggggaaaaa       c.*540

          .         .         .         .         .         .       g.7099
 caaaaaaaaacttaaaatacaaaaaacaacattctatttatttattgaggacccatggta       c.*600

          .         .         .         .         .         .       g.7159
 aaatgcaaatagatccggtgtctaaatgcattcatatttttatgattgttttgtaaatat       c.*660

          .         .         .         .                           g.7205
 ctttgtatatttttctgcaataaataaatataaaaaatttagagaa                     c.*706

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Twist basic helix-loop-helix transcription factor 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center