thioredoxin-like 4A (TXNL4A) - coding DNA reference sequence

(used for variant description)

(last modified April 21, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_006701.2 in the TXNL4A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000018.9, covering TXNL4A transcript NM_006701.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5020
                                         gtttgcgtgtgcgggcggga       c.-121

 .         .         .         .         .         .                g.5080
 ccggatttcgtccgtgggcccgggggcggcgggggccggggagtgaggggccggctgagc       c.-61

 .         .         .         .         .         .                g.5140
 ccacctcgctgggccctccctggcgccccgccttgggcggcggcgagcgcgcgggccgcc       c.-1

          .         .         .         .         .         .       g.5200
 ATGTCGTACATGCTCCCGCACCTGCACAACGGCTGGCAGGTGGACCAGGCCATCCTCTCG       c.60
 M  S  Y  M  L  P  H  L  H  N  G  W  Q  V  D  Q  A  I  L  S         p.20

          .         .         .         .         .         .       g.5260
 GAGGAGGACCGCGTGGTCGTCATCCGCTTCGGCCACGACTGGGATCCTACGTGCATGAAG       c.120
 E  E  D  R  V  V  V  I  R  F  G  H  D  W  D  P  T  C  M  K         p.40

          .         .         .    | 02    .         .         .    g.15858
 ATGGACGAGGTCCTGTACAGCATCGCCGAGAAG | GTTAAAAATTTTGCAGTTATTTATCTT    c.180
 M  D  E  V  L  Y  S  I  A  E  K   | V  K  N  F  A  V  I  Y  L      p.60

          .         .         .         .         .         .       g.15918
 GTGGATATTACAGAAGTGCCTGACTTCAACAAAATGTATGAGTTATACGATCCATGTACT       c.240
 V  D  I  T  E  V  P  D  F  N  K  M  Y  E  L  Y  D  P  C  T         p.80

          .        | 03.         .         .         .         .    g.19719
 GTCATGTTTTTCTTCAG | GAACAAGCACATCATGATTGACTTGGGGACTGGCAACAACAAC    c.300
 V  M  F  F  F  R  |  N  K  H  I  M  I  D  L  G  T  G  N  N  N      p.100

          .         .         .         .         .         .       g.19779
 AAGATTAACTGGGCCATGGAGGACAAGCAGGAGATGGTGGACATCATCGAGACGGTGTAC       c.360
 K  I  N  W  A  M  E  D  K  Q  E  M  V  D  I  I  E  T  V  Y         p.120

          .         .         .         .         .         .       g.19839
 CGCGGGGCCCGCAAAGGCCGCGGCCTGGTGGTGTCCCCCAAGGACTACTCCACCAAGTAC       c.420
 R  G  A  R  K  G  R  G  L  V  V  S  P  K  D  Y  S  T  K  Y         p.140

                                                                    g.19848
 CGCTACTGA                                                          c.429
 R  Y  X                                                            p.142

          .         .         .         .         .         .       g.19908
 ggcgccctcagtctgcgcggataaatgtcgtggagccctttttgtatggaaacgttttaa       c.*60

          .         .         .         .         .         .       g.19968
 gctatttaaagcctttggaaaatacaggaagctccagggctggagcacctctgagatgga       c.*120

          .         .         .         .         .         .       g.20028
 attgataacatggtcttaactcaccgaaataaacaagcacgtggtgagaggagcaggcct       c.*180

          .         .         .         .         .         .       g.20088
 acttgtttgttctcaggaaacttaatgaatagattactgattttcctagtcaaagttaat       c.*240

          .         .         .         .         .         .       g.20148
 tcttacccttggagtaaaacgaaggtgtttatcctgtgagcctgtgcgttttgcatactg       c.*300

          .         .         .         .         .         .       g.20208
 ggttggtttgctggggctgcggtgacagcatatgccgcgagctgggctttaacagagatg       c.*360

          .         .         .         .         .         .       g.20268
 tgtgctctcacagctttgcaggcgggggtctgagatcagggtgtcgcgggtggggggtca       c.*420

          .         .         .         .         .         .       g.20328
 ctgctgaggccgtgaggggaatctgctcaggcctgtccctggcttctgggggctgctggt       c.*480

          .         .         .         .         .         .       g.20388
 ggtattttcagttccttggtgtgtggatacttcgccccatctctgccttcacctgtgtcc       c.*540

          .         .         .         .         .         .       g.20448
 tccctgtgtgggtgctggtgtccaaaatttccccttttcgtagtgacaccagctgtgttg       c.*600

          .         .         .         .         .         .       g.20508
 gattggggcccaccctgctccagcatggcctaatcttaactaattacatttgcaaggatc       c.*660

          .         .         .         .         .         .       g.20568
 ttatgtccacaaaagtcacagtctgaggtgctgggggttaggacttcaatatataaattt       c.*720

          .         .         .         .         .         .       g.20628
 tgcggttacacaattcaatccatgacagaatccaaaggtttactctggttataaaaacag       c.*780

          .         .         .                                     g.20666
 tacaataaaatattgtttatagccttccctgtaaggaa                             c.*818

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Thioredoxin-like 4A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.