TYRO protein tyrosine kinase binding protein (TYROBP) - coding DNA reference sequence

(used for variant description)

(last modified August 31, 2012)

This file was created to facilitate the description of sequence variants on transcript NM_003332.3 in the TYROBP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering TYROBP transcript NM_003332.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5021
                                        agacttcctccttcacttgcc       c.-61

 .         .         .         .         .         .                g.5081
 tggacgctgcgccacatcccaccggcccttacactgtggtgtccagcagcatccggcttc       c.-1

          .         .         .         .         .         .       g.5141
 ATGGGGGGACTTGAACCCTGCAGCAGGCTCCTGCTCCTGCCTCTCCTGCTGGCTGTAAGT       c.60
 M  G  G  L  E  P  C  S  R  L  L  L  L  P  L  L  L  A  V  S         p.20

   | 02      .         .         .     | 03   .         .         . g.5755
 G | GTCTCCGTCCTGTCCAGGCCCAGGCCCAGAGCG | ATTGCAGTTGCTCTACGGTGAGCCCG c.120
 G |   L  R  P  V  Q  A  Q  A  Q  S  D |   C  S  C  S  T  V  S  P   p.40

          .         .         .         .         .         .       g.5815
 GGCGTGCTGGCAGGGATCGTGATGGGAGACCTGGTGCTGACAGTGCTCATTGCCCTGGCC       c.180
 G  V  L  A  G  I  V  M  G  D  L  V  L  T  V  L  I  A  L  A         p.60

          .         .         .         .          | 04        .    g.6056
 GTGTACTTCCTGGGCCGGCTGGTCCCTCGGGGGCGAGGGGCTGCGGAGG | CAGCGACCCGG    c.240
 V  Y  F  L  G  R  L  V  P  R  G  R  G  A  A  E  A |   A  T  R      p.80

          .         .         .       | 05 .         .         .    g.8699
 AAACAGCGTATCACTGAGACCGAGTCGCCTTATCAG | GAGCTCCAGGGTCAGAGGTCGGAT    c.300
 K  Q  R  I  T  E  T  E  S  P  Y  Q   | E  L  Q  G  Q  R  S  D      p.100

          .         .         .         .                           g.8741
 GTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAATGA                         c.342
 V  Y  S  D  L  N  T  Q  R  P  Y  Y  K  X                           p.113

          .         .         .         .         .         .       g.8801
 gcccgaatcatgacagtcagcaacatgatacctggatccagccattcctgaagcccaccc       c.*60

          .         .         .         .         .         .       g.8861
 tgcacctcattccaactcctaccgcgatacagacccacagagtgccatccctgagagacc       c.*120

          .         .         .         .                           g.8909
 agaccgctccccaatactctcctaaaataaacatgaagcacaaaaaca                   c.*168

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The TYRO protein tyrosine kinase binding protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.