ubiquitin-conjugating enzyme E2A (UBE2A) - coding DNA reference sequence

(used for variant description)

(last modified June 8, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_003336.2 in the UBE2A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering UBE2A transcript NM_003336.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5056
     acactggggtggtgcttagccggcgccagaccgaccctcgacttcggagaggcagc       c.-121

 .         .         .         .         .         .                g.5116
 gcggttcctctgggtgcttccgcctccccttctcctgcttctccagcctcttcggcctcc       c.-61

 .         .         .         .         .         .                g.5176
 tcgcccgccgcgggaacccgagaccccagtgtatgccccacccctgaccccgctcgcgac       c.-1

          .         .         .         .     | 02   .         .    g.5381
 ATGTCCACCCCGGCTCGGCGGCGCCTCATGCGGGACTTCAAGAG | GTTGCAGGAGGATCCT    c.60
 M  S  T  P  A  R  R  R  L  M  R  D  F  K  R  |  L  Q  E  D  P      p.20

          .         .         .         .         .         .       g.5441
 CCAGCCGGAGTCAGCGGGGCTCCGTCCGAGAACAACATAATGGTGTGGAACGCGGTCATT       c.120
 P  A  G  V  S  G  A  P  S  E  N  N  I  M  V  W  N  A  V  I         p.40

       | 03  .         .         .  | 04      .         .         . g.12000
 TTCGG | GCCTGAAGGGACCCCGTTTGAGGATG | GAACATTTAAACTTACAATAGAATTCACT c.180
 F  G  |  P  E  G  T  P  F  E  D  G |   T  F  K  L  T  I  E  F  T   p.60

          .         .         .         .         .         .       g.12060
 GAAGAATATCCAAATAAACCACCTACAGTTAGATTTGTCTCTAAGATGTTCCATCCAAAT       c.240
 E  E  Y  P  N  K  P  P  T  V  R  F  V  S  K  M  F  H  P  N         p.80

   | 05      .         .         .         .         .         .    g.13111
 G | TCTATGCAGATGGTAGTATATGTCTGGACATACTTCAGAACCGTTGGAGTCCAACCTAT    c.300
 V |   Y  A  D  G  S  I  C  L  D  I  L  Q  N  R  W  S  P  T  Y      p.100

          .         .         . | 06       .         .         .    g.13621
 GATGTGTCTTCCATTCTAACATCCATACAG | TCTCTGTTGGATGAACCCAATCCCAATAGT    c.360
 D  V  S  S  I  L  T  S  I  Q   | S  L  L  D  E  P  N  P  N  S      p.120

          .         .         .         .         .         .       g.13681
 CCAGCAAACAGCCAGGCTGCTCAGCTGTACCAGGAGAACAAACGGGAATATGAAAAGCGT       c.420
 P  A  N  S  Q  A  A  Q  L  Y  Q  E  N  K  R  E  Y  E  K  R         p.140

          .         .         .                                     g.13720
 GTTTCTGCAATAGTAGAACAAAGCTGGCGTGATTGTTGA                            c.459
 V  S  A  I  V  E  Q  S  W  R  D  C  X                              p.152

          .         .         .         .         .         .       g.13780
 ccccgggtacagtttaaagaagctggccataagaaaaatatatattgatgtgtttgtcac       c.*60

          .         .         .         .         .         .       g.13840
 ctccctactcctgtcattacatttactttattaaaagcaaaataactgttgtgctgtttc       c.*120

          .         .         .         .         .         .       g.13900
 catcttccttgccaagttttcctaccccttctaccctctccttaaacatcagaaaacacc       c.*180

          .         .         .         .         .         .       g.13960
 ctctatgaaatcaaatgtactgtacctgggttacttgcaaaaattactaatgcttcagtt       c.*240

          .         .         .         .         .         .       g.14020
 tttctgttgtatttcatttccagttttcaggcagttatttttattattgtactttaagct       c.*300

          .         .         .         .         .         .       g.14080
 tttaagatgaattgttatacaagaggtgcttatgcttagcttgatgaccaggatgttatt       c.*360

          .         .         .         .         .         .       g.14140
 tttaacaaaatgattgctgaagtgtttcatcctggctggtccttcacttgtgttggattt       c.*420

          .         .         .         .         .         .       g.14200
 agaagtgaatgtgtttggaatatggcctacagagaatagaaacaaatccatgtaaacaat       c.*480

          .         .         .         .         .         .       g.14260
 tttgaaggaggcatgggagctaaaaatcctgtgatactaagatctcagtcatatgaatta       c.*540

          .         .         .         .         .         .       g.14320
 caacgtagtatttactggcaagaaggagaaagttgaaggactcagctaaaggagtacagc       c.*600

          .         .         .         .         .         .       g.14380
 aattgtagtaactgacacatcctctctttgcaagctgctgactgggcacactcatgccaa       c.*660

          .         .         .         .         .         .       g.14440
 gtttcagaattattggtcttctgggtttttgctttttaaaagaggtgtgggagcagagga       c.*720

          .         .         .         .         .         .       g.14500
 atggaaacaatcgtgagtttttgagctagggaaagttggagctcctttaatctttttaaa       c.*780

          .         .         .         .         .         .       g.14560
 ggatcagtgctgccctaagtgaataaactcaattgtccatctttattttagagttttaat       c.*840

          .         .         .         .         .         .       g.14620
 gaattcaaggaagggagcatagcatatctgtggcaaactattttccactcaaatcctgag       c.*900

          .         .         .         .         .         .       g.14680
 ttattgctgcatgctttaatttcttccctttcagcatctgagaaccttaaagccaatgtc       c.*960

          .         .         .         .         .         .       g.14740
 tgcgatctttttttggatatttatacttttagatatatagtacctttaagtagcagtatg       c.*1020

          .         .         .         .         .         .       g.14800
 ggacaaggcttgtaaatgttttgtctaatgttctattgtcaccttttatgcatttatcac       c.*1080

          .         .         .         .         .         .       g.14860
 ttccaaatctaactttgcacaagtaacccatgtaaaaaaaaatgtacatttttcaaaagt       c.*1140

          .         .                                               g.14883
 tgtaaataaaaataaccttaaaa                                            c.*1163

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ubiquitin-conjugating enzyme E2A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.