ubiquitin-fold modifier conjugating enzyme 1 (UFC1) - coding DNA reference sequence

(used for variant description)

(last modified August 20, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_016406.3 in the UFC1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering UFC1 transcript NM_016406.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5014
                                               cggaagtcaccctt       c.-241

 .         .         .         .         .         .                g.5074
 tgtgccttatgcggtgattttaatgataggtgtcatatataggacggagtaatctgttta       c.-181

 .         .         .         .         .         .                g.5134
 cattctgttcttctcgatgcactcacaagcgggtaactaggtgacaagaaaacaaagatc       c.-121

 .         .         .         .         .         .                g.5194
 ttattcaaaagaggtcttacagcaacccaacgtctcatcttcccatagtaaagatgacgg       c.-61

 .         .         .         .         .         .                g.5254
 cgccttgaggtaagctacaggcaacaccacttccgcgtttctcttgcgccctggtccaag       c.-1

          .         .         .         .         .         .       g.5314
 ATGGCGGATGAAGCCACGCGACGTGTTGTGTCTGAGATCCCGGTGCTGAAGACTAACGCC       c.60
 M  A  D  E  A  T  R  R  V  V  S  E  I  P  V  L  K  T  N  A         p.20

          .         .         .         .         .         .       g.5374
 GGACCCCGAGATCGTGAGTTGTGGGTGCAGCGACTGAAGGAGGAATATCAGTCCCTTATC       c.120
 G  P  R  D  R  E  L  W  V  Q  R  L  K  E  E  Y  Q  S  L  I         p.40

     | 02    .         .         .         .         .         .    g.8263
 CGG | TATGTGGAGAACAACAAGAATGCTGACAACGATTGGTTCCGACTGGAGTCCAACAAG    c.180
 R   | Y  V  E  N  N  K  N  A  D  N  D  W  F  R  L  E  S  N  K      p.60

          .  | 03      .         .         .         .         .    g.8559
 GAAGGAACTCG | GTGGTTTGGAAAATGCTGGTATATCCATGACCTCCTGAAATATGAGTTT    c.240
 E  G  T  R  |  W  F  G  K  C  W  Y  I  H  D  L  L  K  Y  E  F      p.80

          .      | 04  .         .         .         .         .    g.8918
 GACATCGAGTTTGAC | ATTCCTATCACATATCCTACTACTGCCCCAGAAATTGCAGTTCCT    c.300
 D  I  E  F  D   | I  P  I  T  Y  P  T  T  A  P  E  I  A  V  P      p.100

          .         .         .   | 05     .         .         .    g.9405
 GAGCTGGATGGAAAGACAGCAAAGATGTACAG | GGGTGGCAAAATATGCCTGACGGATCAT    c.360
 E  L  D  G  K  T  A  K  M  Y  R  |  G  G  K  I  C  L  T  D  H      p.120

          .         .         .         .         .         .       g.9465
 TTCAAACCTTTGTGGGCCAGGAATGTGCCCAAATTTGGACTAGCTCATCTCATGGCTCTG       c.420
 F  K  P  L  W  A  R  N  V  P  K  F  G  L  A  H  L  M  A  L         p.140

     | 06    .         .         .         .         .         .    g.9725
 GGG | CTGGGTCCATGGCTGGCAGTGGAAATCCCTGATCTGATTCAGAAGGGCGTCATCCAA    c.480
 G   | L  G  P  W  L  A  V  E  I  P  D  L  I  Q  K  G  V  I  Q      p.160

          .         .                                               g.9749
 CACAAAGAGAAATGCAACCAATGA                                           c.504
 H  K  E  K  C  N  Q  X                                             p.167

          .         .         .         .         .         .       g.9809
 agaatcaagccactgaggcagggcagagggacctttgataggctacgatactattttcct       c.*60

          .         .         .         .         .         .       g.9869
 gtgcatcacacttaactcatctaactgcttccccggacaccctccacctctagttgttac       c.*120

          .         .         .         .         .         .       g.9929
 taagtagctgcagtaggcattgctggggaagaaacaaacacacaccaaacagtactgcta       c.*180

          .         .         .         .         .         .       g.9989
 cttagtttctaaggctgcacagggaagggaaagactgggctttggacaatctagaggtaa       c.*240

          .         .         .         .         .         .       g.10049
 tttatatccgcccccaggtggagcaacatgcgattctggaggcacgggggtaactgaaag       c.*300

          .         .         .         .         .         .       g.10109
 tgagtacatatagtctttctggtttctggagataacccatcaataaaagctgcttcctct       c.*360

                                                                    g.10113
 ggta                                                               c.*364

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ubiquitin-fold modifier conjugating enzyme 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.