UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3B) - 315 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.19722
gtcagtagtcaaggactctttgttatgtttgatttatacatgctagttttgctgctatgt  c.1007+60

         .         .         .         .         .         .  g.19782
cctggacatgtacctgaattaagataagctgttttatgcagggcagggggatgaggagga  c.1007+120

         .         .         .          g.19820
acagtttcagaatattcttgtatcttaatctgggtgaa  c.1007+158

--------------------- middle of intron ---------------------
           g.19821            .         .         .           g.19857
           c.1008-157  tggttttggggttttgttccttcttaaaacactagta  c.1008-121

.         .         .         .         .         .           g.19917
tttttcactctgctctaaaagtgcaacctcattgcaggggccaaatcagaatcacagtgt  c.1008-61

.         .         .         .         .         .           g.19977
tcctgcatttgtgattacaagatctttcagggttctgtctcagatttgtttttcatgcag  c.1008-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center