ubiquitin specific peptidase 9, X-linked (USP9X) - downstream reference sequence


         .         .         .            .         .         . g.155970
agcacatatacaaaaataaaactttataaattcaa / tttcggttttccctttatttattaa c.*4080

         .         .         .         .         .         .    g.156030
tacaagatttctaaacaaggtagatgtgtaatagagctgaagggaattttttaaagggaa    c.*4140

         .         .         .         .         .         .    g.156090
atgtttatgaggaattcagccatcattgtgtatatccaaagtggattcacacctaaggac    c.*4200

         .         .         .         .         .         .    g.156150
ctcaaagaaatgagttgtgatctaattgcagactttagagttaaaactaagattcagcaa    c.*4260

         .         .         .         .         .         .    g.156210
actgtggtgtttcagttctcttaaactggaaataaagcagaccacatgttttgaggggag    c.*4320

         .         .         .         .         .         .    g.156270
ccacagaagtgaaagttaactctctagcaagttccatctgctgttttttagtgtctagaa    c.*4380

         .         .         .         .         .         .    g.156330
atagctctttgttgtcatgtcccagggaaattaagatttcctcagaaacctggaggtgct    c.*4440

         .         .         .         .         .         .    g.156390
ttcctaaagttgggttacttcaagaactgctaaaagacaaatctcagattttcactggat    c.*4500

         .         .         .         .         .         .    g.156450
ttaatttcactgatttttttaaatagaaaactaatatttaacttttctgcaatttggaaa    c.*4560

         .         .         .         .         .         .    g.156510
actccctccagttggattagactgtattttaagtatttttagctacatgagtacatctaa    c.*4620

         .         .         .         .         .         .    g.156570
ctgaaaatctacatcaccaccaatattttgaattgtttcttgtaatctggtaacttagag    c.*4680

         .         .         .         .         .         .    g.156630
ataggcaaaaagttgacatctttatttttatctgtacctgaaagtttagatactcttact    c.*4740

         .         .         .         .         .         .    g.156690
aaagttggggttacataaaacgtttcagtaactttagggaggtaaaatctcaagagaaat    c.*4800

         .         .         .         .         .         .    g.156750
ttcttaaattacaccaaaaaactttcctaaatagaacacgtttcagagccatttaaataa    c.*4860

         .         .         .         .         .         .    g.156810
aggttgattattttaaggtcattctatttaaatggtcaaaactcaagagtaaaataggaa    c.*4920

         .         .         .         .         .         .    g.156870
tcattttagccatctgagaaaacaagtctcattctgatccattaacattagacaatatac    c.*4980

         .         .         .         .         .         .    g.156930
tgcatttcaacaaatccaagatgccattggttacaaggcgcctcagcaagcaaaatcact    c.*5040

         .         .         .         .         .         .    g.156990
gactttcatggatattaaaacgtggggtatcccatctggtagtaatccttgtcatgacaa    c.*5100

         .         .         .         .         .         .    g.157050
acgtcttttcacatctggaaataggtttttgtagtgggcttttctcacattgcttttttt    c.*5160

         .         .         .         .         .         .    g.157110
tccattagtggaacttagaaaccctatttttatgtgtaattgctaacaaagctggccaat    c.*5220

         .         .         .         .         .         .    g.157170
ttacaagtttatgaagaaatggcttgatggaactgaacctttgaggagtcaccgaattat    c.*5280

         .         .         .         .         .         .    g.157230
taatgaagtgccctgtgtaagcggtcttcttgagatagttttgtgtcgtagcttctggtt    c.*5340

         .         .         .         .         .         .    g.157290
ttcacatgcattatagttaagacaccaagtggactttcttgctctgccagtatggttcag    c.*5400

         .         .         .         .         .         .    g.157350
ctgccctggactagtctctgcctgtcaaagcactccctatgttagaaaatgagtatagag    c.*5460

         .         .         .         .         .         .    g.157410
gccaggcgtggtggctcacgcctgtaatcccaccagttggaaaggccgaagcgggtggat    c.*5520

         .         .         .         .         .         .    g.157470
cacctgaggtcgggagttcgagaccagcctggccaacattgtgaaaccctgtctctacta    c.*5580

         .         .         .         .         .         .    g.157530
aaaatacaaaaattagctgggtgtggtggcgcacgcctgtaatcccagctactcaggagg    c.*5640

         .         .         .         .         .         .    g.157590
ctgaggcacgagagtaacttgaaccagaggcagaggttgcagtgagccgagatggggcca    c.*5700

         .         .         .         .         .         .    g.157650
ctgcactgtagcctgggcgacggagtgaaactctcaaaaaaaaaagaaactggcttctgt    c.*5760

         .         .         .         .         .         .    g.157710
agccttcccagcactagccaaactcctcaaaggtaagcaagtgggggccaccttgcaaga    c.*5820

         .         .         .         .         .         .    g.157770
tagtaagaattgtgttcattttctatttatattcaaccctatagatgtgtttaaaaaaca    c.*5880

         .         .         .         .         .         .    g.157830
aaatattccaaataggtactttgggtattggaacatttttttccatggagtcctttttag    c.*5940

         .         .         .         .         .         .    g.157890
caattcagttgcatcaggaatagaaatgtattcttaacagtgttgctgctgtgtctctta    c.*6000

         .         .         .         .         .              g.157946
aatcacttgccattaattatcttatgttctcatctaattcttcccccacccattaa        c.*6056


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center