ubiquitin specific peptidase 9, X-linked (USP9X) - 2311 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.48571
gtgagttggtgtgtaacacccaagaaagagagcagacaggaaagtaaccccactgcctcc  c.242+60

         .         .         .         .         .         .  g.48631
ttaatagtctttatagcttcgtcactgccaagtgctttataacccatgattcttaataga  c.242+120

         .         .         .         .         .         .  g.48691
tttaataaatgaaagggagtgacagtgttagtaaaaatttcacattaatgatgatgaccc  c.242+180

         .         .         .         .         .         .  g.48751
tagttgggttgtttccgaagtaaaattgtatgttcagtttccctcttggagagtttatga  c.242+240

         .         .         .         .         .         .  g.48811
agtttttttctcattggtctcttggttgctggatgactttcataatttttgggatggcct  c.242+300

         .         .         .         .         .         .  g.48871
gaggtaaatcaggtcatgaggacattgagttcctcagagcctgatcctagtgaactcttg  c.242+360

         .         .         .         .         .         .  g.48931
actagtttgagctatttaaccatcctagatgtttcctttttttggtcttcatctcaggga  c.242+420

         .         .         .         .         .         .  g.48991
acagttcagaatataatttttcacacttatagtacaaacaaccaccctatcccaccccac  c.242+480

         .         .         .         .         .         .  g.49051
acactttgattatttagaggaaacctccaagagagtgaagctttaagcttttgtgcagag  c.242+540

         .         .         .         .         .         .  g.49111
gaagaaaaagatttcaagaggctagggaagagcacatcaaggaatcccatgtgactgtga  c.242+600

         .         .         .         .         .         .  g.49171
tcttcaccagactgtgggctcaacaagtgagtgctaggaaggtgcgacacatttccccct  c.242+660

         .         .         .         .         .         .  g.49231
cactccccaaaaggaaagtaatgaaaacacatgttcttaaaggcacttgctttactgagt  c.242+720

         .         .         .         .         .         .  g.49291
ttttttttaaatttcattttctaaaaataagtcaacactattaaatgcataatgtgaggg  c.242+780

         .         .         .         .         .         .  g.49351
gaaatagaaatcctttgcattaaaaaaagaaatctaaatacataaataatgagtatgcgt  c.242+840

         .         .         .         .         .         .  g.49411
taacagaaatattttgtgtaggtaaatttctctgtaatttcccccttacatacacatatt  c.242+900

         .         .         .         .         .         .  g.49471
cctgccaaaaattactgttaacaatcaatacattcttcagattacctttgtgtttactat  c.242+960

         .         .         .         .         .         .  g.49531
catatatgaattgatttttctataaatagaggattcttactataattttgtaacttgctt  c.242+1020

         .         .         .         .         .         .  g.49591
tcatttatcttgaatatttttcctattaataaattccattgtttttaattatatatttat  c.242+1080

         .         .         .         .         .         .  g.49651
aagaatacattgtgtgattctggcaggtgcctatagtaatggtatataataaattatatt  c.242+1140

         .        g.49667
taatagtggtccctga  c.242+1156

--------------------- middle of intron ---------------------
                                 g.49668          .           g.49682
                                 c.243-1155  ccattctctatagca  c.243-1141

.         .         .         .         .         .           g.49742
gtgataccatagcagaaggttgtattgtttgttgcttttccatacttgtctggtggttgg  c.243-1081

.         .         .         .         .         .           g.49802
tgattggtaataaaatacttcttaggctaaagttgcatattattagcaagttctcagggg  c.243-1021

.         .         .         .         .         .           g.49862
ggagaaaaatacaaatgattttttttttctttttttctttttttttttgttttttgtttt  c.243-961

.         .         .         .         .         .           g.49922
ttgttttttttgagatggagtctcgctctgtcaccaggctggagtgcagtggtgtgatct  c.243-901

.         .         .         .         .         .           g.49982
cggctcactgcaaccttcgcctcctgggttcaagcgattctcctgcctcagcctcccgag  c.243-841

.         .         .         .         .         .           g.50042
tagctaggactacaggcacgtgccaccatacccagctaatttttgtgttagtagagatgg  c.243-781

.         .         .         .         .         .           g.50102
ggtttcaccatgttggccaggatggtcttgatctcttttcttttctttttcttttttttt  c.243-721

.         .         .         .         .         .           g.50162
tccttttgagacggtgtctcactctgttgcccaggctgtagtgcagtagcacaatcttgg  c.243-661

.         .         .         .         .         .           g.50222
ctcactgcaacctccgcctcccaggttcaagcgattctcctgcctcagcctcccgagtag  c.243-601

.         .         .         .         .         .           g.50282
ctgagattacaggcatgtgccatcacacctggctaatttttgtatttttagtagagacgt  c.243-541

.         .         .         .         .         .           g.50342
catttcaccatgttggccaggctggtctcgaacgcctgatgtcaggtgatcctcctgcct  c.243-481

.         .         .         .         .         .           g.50402
cggcctcccaaagtgctgggattagaggcgtgagccactgctcccgggcaaccctgtctc  c.243-421

.         .         .         .         .         .           g.50462
ttaccaaaaaaaaaaaggggggtggcggggcaatgaagaggtttatcataatgtctcctt  c.243-361

.         .         .         .         .         .           g.50522
tgatctgaatcctgaaagagcacttccctatgaattttaacaaaaatatccatgatacct  c.243-301

.         .         .         .         .         .           g.50582
aattagttaatatttgattgttataatagttttatatcctaagttatcaagataatttag  c.243-241

.         .         .         .         .         .           g.50642
ttttcttccctctcttattgctgtatcttttgacagtacctgtaaaaatttgtagagaca  c.243-181

.         .         .         .         .         .           g.50702
tcaggtggtgcttagtcccacaaagcagataatctgccaaccttgtcttaatattttaat  c.243-121

.         .         .         .         .         .           g.50762
gttattttaatattaatattaaatattttcatagcaagataattataattagtagctcat  c.243-61

.         .         .         .         .         .           g.50822
ttgtagtgcctcttttagtgtacaaccattaagcatgtttttgtttggtaaaacttttag  c.243-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center