ubiquitin specific peptidase 9, X-linked (USP9X) - 1966 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.54263
gtgagtcttgcatttgactttaaaggatcagatttacatagtgatgcctgtgagtgggaa  c.435+60

         .         .         .         .         .         .  g.54323
gaggtatatgtgtgtgtggctgtgttatatttattctgttataattgaattaaaaggtct  c.435+120

         .         .         .         .         .         .  g.54383
aaaaatgaaaaacttaaaaatgtttataaattaagtctcttgaaggccgcatggtcattt  c.435+180

         .         .         .         .         .         .  g.54443
agaataagcatgagatttagagttaagcttgggtttaatctctcctctgggatctcaagt  c.435+240

         .         .         .         .         .         .  g.54503
gtctgtgaccttaggcaagtcatcacatttcattgaaaatgtaatgctatcaattgtaag  c.435+300

         .         .         .         .         .         .  g.54563
gtacatcactgttttatggactattaaggaagaaaaacacccaagatggggcatttcata  c.435+360

         .         .         .         .         .         .  g.54623
tacgtctgggacaccaaagggtcagtatagaggtaaatgagaaatgaacttgctatgcag  c.435+420

         .         .         .         .         .         .  g.54683
aaagggacagcaaaaaatcctgcatatctcaaccttggcacttggtggagggagggatta  c.435+480

         .         .         .         .         .         .  g.54743
aaaaaaaaagtgaaaatctaaaccacaagccagtatttaaacagtttcgtagtctgaatt  c.435+540

         .         .         .         .         .         .  g.54803
caaattatagttgcaatacaaaaagcccttaagtggaaaatgtaaagtggtctcatgtcg  c.435+600

         .         .         .         .         .         .  g.54863
gtagtgcccccaagtgactagcagaagcaaacacaattcctctctgcaaataccttccat  c.435+660

         .         .         .         .         .         .  g.54923
ttaggaaaacagtaatgtattgttcattgattataagatagagtcagattccagagatct  c.435+720

         .         .         .         .         .         .  g.54983
taaaaagtgaaaaaagtatatgtctcagactgataaaatgccataactactctaagtctc  c.435+780

         .         .         .         .         .         .  g.55043
tgttgcttttgttttttgtgtgtccccccgcaagacggagtctcactctgtctcccaggc  c.435+840

         .         .         .         .         .         .  g.55103
tggagtgtagtggtgcgatctcagctcactgcaacctccgcctcccaggttgaagtgatt  c.435+900

         .         .         .         .         .         .  g.55163
cttctgcctcagcctcccgagtagctgggactacaggcgtgcgccaccacgcctggctaa  c.435+960

         .         .     g.55186
tttttgtatttttaggagagatg  c.435+983

--------------------- middle of intron ---------------------
                          g.55187       .         .           g.55209
                          c.436-983  gggtttcaccatgttggccaggc  c.436-961

.         .         .         .         .         .           g.55269
tggtctcgaactcctgtcctcaagtgatccgcctgcctcagcctcccaaagtgctgggat  c.436-901

.         .         .         .         .         .           g.55329
tacaggtgtgagcccccatgcccggcctctgttcttttgtatactatggaaatggtcata  c.436-841

.         .         .         .         .         .           g.55389
agttgtcaagcagataatatttttgtggcctataacctatttcccaaatatgaccatagc  c.436-781

.         .         .         .         .         .           g.55449
ataaaaattccacattttctgatttaacatgtaattgtataggtgtagaaatggaaactt  c.436-721

.         .         .         .         .         .           g.55509
tggaagtggcgtcagacttctgcatttgacatttagctagcaaatttatcttggatgatt  c.436-661

.         .         .         .         .         .           g.55569
gacatattgtttattttatttatttttattttttgagacagagtcttgctctgttgccca  c.436-601

.         .         .         .         .         .           g.55629
ggctggagtgcagtggcgccatcttggcttccttggagcctctgcctcctgggttcgagc  c.436-541

.         .         .         .         .         .           g.55689
tattctcatgcctcagcctcccgagtagctgggactacaggcacatgccagcacacgtgg  c.436-481

.         .         .         .         .         .           g.55749
ctaatttttgtatttttagtagagacagggtttcaccctgttggccaggctgatctcaaa  c.436-421

.         .         .         .         .         .           g.55809
ctcctggcctcaagtgatccgctttcctcagcctcccaaagtgttgggattaacaggcgt  c.436-361

.         .         .         .         .         .           g.55869
gagccactgtgctcagcctgacatactgtttagactctagaattgctgcctctcgtgtac  c.436-301

.         .         .         .         .         .           g.55929
aaattccacagagaaaaaatagtaacttgcatcttacctgtggacgtagagcaggaatag  c.436-241

.         .         .         .         .         .           g.55989
atatcttatggtgcctcttgtattttttaagccatagcaaatggcttttgaaagtaccat  c.436-181

.         .         .         .         .         .           g.56049
ataaattatgaagtaaacaaattctaatttgtcctttgataatcagtttgatcccaatat  c.436-121

.         .         .         .         .         .           g.56109
taatgattagaaaaatggagagatcgttatttgttaggatacgattaatattggaagata  c.436-61

.         .         .         .         .         .           g.56169
tttctgtttgaaattgcagtgttttgatcttgtaaatcgcctttcccccttgtataacag  c.436-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center