ubiquitin specific peptidase 9, X-linked (USP9X) - 3633 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.56448
gtgtgttggtttgttattttcaaaattaaataatacaattgttttgttctgacacagaat  c.654+60

         .         .         .         .         .         .  g.56508
cttcagtgatctgtatttaaagtgtgacaatgaaataacactttaaatgaaaatacacac  c.654+120

         .         .         .         .         .         .  g.56568
aaccaggagcctttttcgtagctttgtcgttctagttctttgttttttctgcatgtataa  c.654+180

         .         .         .         .         .         .  g.56628
ttatccccattgtcttctgtccagcctctttagaagtagtcataatttgggttagtagga  c.654+240

         .         .         .         .         .         .  g.56688
aacagactgtattttttctttgaaatagagtaggagattacttctttgaccaaggactca  c.654+300

         .         .         .         .         .         .  g.56748
attgttgttctgtagggccgtgatcattttaggcattctaagattttgactccaaaatca  c.654+360

         .         .         .         .         .         .  g.56808
agtatatcctctaaatacctaataatacatcataaaattacagaaattgttaatgaaatc  c.654+420

         .         .         .         .         .         .  g.56868
aatatagtaaatcttccaaatctcacttaaatatattgtgtacataaatgtaagttttct  c.654+480

         .         .         .         .         .         .  g.56928
atattggtgtaaacagactgtacactttaaaaaatttttccctaaacgctgcttctttta  c.654+540

         .         .         .         .         .         .  g.56988
ataaatattatataattttaaaattttagattttagggagacatttttaatattataggt  c.654+600

         .         .         .         .         .         .  g.57048
cttgtacaaatttccctttttctatccagccagaaagattttaagtcatacattatggag  c.654+660

         .         .         .         .         .         .  g.57108
aacttggtttattttactaataagctgaagttatcaaaaaaaggtcaaacttaagttgag  c.654+720

         .         .         .         .         .         .  g.57168
attttctgatatttcctagttcatatagttgccactagatggcttatttttgcttgagta  c.654+780

         .         .         .         .         .         .  g.57228
gatcaggttactatctaaataatggcagtcttcaaaatgaaaattttaatctatacctgt  c.654+840

         .         .         .         .         .         .  g.57288
atttctttttaaattttactttttttttttctctatgtgccagtaatccacaacttaaga  c.654+900

         .         .         .         .         .         .  g.57348
gattcacagggcacaaaacttgatttaacatggctaaatgtaaaatttttagatgacttc  c.654+960

         .         .         .         .         .         .  g.57408
tggttgaagatagttttatatctttgaaatatagttcttgctattaaacttataaagtgt  c.654+1020

         .         .         .         .         .         .  g.57468
agcgattgtgagagtgttagcctttcaaagccttcaagagtacaatttttaaaaatatag  c.654+1080

         .         .         .         .         .         .  g.57528
cccaaaatatagttgcgaatcaaggagaagcatattctatggagttaccttcacatttac  c.654+1140

         .         .         .         .         .         .  g.57588
ttgctattgaagtaagagaaattttatcatacagctaaacaggtcttctataagctttta  c.654+1200

         .         .         .         .         .         .  g.57648
aaaatctgattaaaaggggacatgtttggcagcatcttcaaccatgtcctagttgaatgc  c.654+1260

         .         .         .         .         .         .  g.57708
agatgtcatgatataatgaaaaatctaagagatatgtaatagcctccatatgtttttttc  c.654+1320

         .         .         .         .         .         .  g.57768
tcctgttctccaaaagtggtagtggcaaaattcagatcatcagacttagtcgatggagat  c.654+1380

         .         .         .         .         .         .  g.57828
aaactttctaagctgtagattcactttcggatactgtttgtaatgagtttcatttacctt  c.654+1440

         .         .         .         .         .         .  g.57888
tgagaaatttgagttacagagcttaaaagtgttttattcggaatatttttgagccttaat  c.654+1500

         .         .         .         .         .         .  g.57948
acttaatcattctctggagcttttggtaggtcttctgttctacttcaaattctctctaca  c.654+1560

         .         .         .         .         .         .  g.58008
cctcctaccctcctgggacattgaacctctgtggcctcaacttttgacccatgacaaagc  c.654+1620

         .         .         .         .         .         .  g.58068
taaagctgtcaggactatctctcagagtgtttcctaatccccatcttcccccaagatgtt  c.654+1680

         .         .         .         .         .         .  g.58128
tgaagatgtttaaatgagatcatttattcaaacatttaaaatataataaaaacttcattg  c.654+1740

         .         .         .         .         .         .  g.58188
gttacgacaaaaggtcttaggtgaaattcaccatgctatctttgagaaaaggaacttgta  c.654+1800

         .         g.58205
gcaatagaaaactatgt  c.654+1817

--------------------- middle of intron ---------------------
                                g.58206           .           g.58221
                                c.655-1816  ggaaagcatatggtga  c.655-1801

.         .         .         .         .         .           g.58281
attgtaagctatgtggtcattttgaattttctatttagggcgactgatctttctctgcca  c.655-1741

.         .         .         .         .         .           g.58341
gtcttgaaaacttagagccagagaaggaaagctgttgttggcagctgctgaagctagcct  c.655-1681

.         .         .         .         .         .           g.58401
attagcctcagtttgaagcactcttatctgaatattcccaattgtttaagcatacattgc  c.655-1621

.         .         .         .         .         .           g.58461
agccaaagaaatacagaaagattagctttagactaattctttactgtgtccacacctgct  c.655-1561

.         .         .         .         .         .           g.58521
gttttataaatattgtatgtaactatcaagtatatcaatctaatagtctcattatagtta  c.655-1501

.         .         .         .         .         .           g.58581
ctgaagaaataaaatatattacataatgagcatgtactttcttacaattgctgaatgaca  c.655-1441

.         .         .         .         .         .           g.58641
aaagggatctggtgaattaagtactcgagttttaatggttttgaattagcctttcatgac  c.655-1381

.         .         .         .         .         .           g.58701
taaaaaggtaggaaaacactattaaattgaaatacgttaatgggtttattagagaaactt  c.655-1321

.         .         .         .         .         .           g.58761
agttcattcatattcttttaaaaccatataaaaactagcagtaggccaggcaaggtggct  c.655-1261

.         .         .         .         .         .           g.58821
cacgcctgtaatcctagcactttgggaggccaagacgggtggatcacctgaagtcaggag  c.655-1201

.         .         .         .         .         .           g.58881
ttcaagaccagcttggccaacatggtgaaaccccatctctactaaaaatacaaaaattag  c.655-1141

.         .         .         .         .         .           g.58941
ccgggtgtggtggtgtgtgcctataatcacagctacttgagaggctgaagcaggagaatc  c.655-1081

.         .         .         .         .         .           g.59001
ctgcttgaaccctggaggcagaggttgcagtgagccgataatcacaccattgcactctgg  c.655-1021

.         .         .         .         .         .           g.59061
gcgacgagagtaaaactccatctcaaaacaaaaaaacacacagaaaaaactagcattagc  c.655-961

.         .         .         .         .         .           g.59121
tatcatattttctctttaaacaaacattgaacatacagccatttagcatctttacttttt  c.655-901

.         .         .         .         .         .           g.59181
cctgtattttttttttaaatagctgtagaaattatttttgcttaaggcttagaagagaaa  c.655-841

.         .         .         .         .         .           g.59241
ttgtgtattttgctccttgttttccagtggcttctaaaacatggcctaaattttagaagg  c.655-781

.         .         .         .         .         .           g.59301
tggcaaggtgtgaaaggttttcttaggtacattaatttctacatatatttgattcttata  c.655-721

.         .         .         .         .         .           g.59361
tttatatagccttttaattcattttaggtttttacatacagacaggcttttagcctcaca  c.655-661

.         .         .         .         .         .           g.59421
actgttgtctgtgccagctgtatggtactttgagctacagctctttcttagacagttcat  c.655-601

.         .         .         .         .         .           g.59481
cctgttgcatggtgttacttctaagataaggagaactgggtgcaatttgtataagcaaaa  c.655-541

.         .         .         .         .         .           g.59541
gtatcaaccagcatattctacttaggaacagtagatactagtaccagaccttagttttta  c.655-481

.         .         .         .         .         .           g.59601
attgacaattgactctcaggctattagttactgtgtttatagggaaattttaatgtttta  c.655-421

.         .         .         .         .         .           g.59661
caactaaacaagaagtagattcaaaattcattaccaagtagcttcttcttaactctcttg  c.655-361

.         .         .         .         .         .           g.59721
aagtctttctgcctcctgaaaattattttaatataaaagactttacagtaattagaaggt  c.655-301

.         .         .         .         .         .           g.59781
attcattcttatatggtgggatatctgaaataggagcatgtcttctaattcctgttcacc  c.655-241

.         .         .         .         .         .           g.59841
acttacattggtacagacagacagaactatgccccagtgatttaatctatacttactacg  c.655-181

.         .         .         .         .         .           g.59901
tatactgcttctgtctcacagatggaattactatgaacaaaatgcaatgttttgtggtcc  c.655-121

.         .         .         .         .         .           g.59961
tttgaaagatgatttattttattgaatttactatttctagtatatttcaataaggctttt  c.655-61

.         .         .         .         .         .           g.60021
ttttcgtgctttttaccctttaaagtaggaagttaacttttttcattaattgtgttacag  c.655-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center