ubiquitin specific peptidase 9, X-linked (USP9X) - 1078 nt intron 10 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.62869
gtaaggaatttaagatgatggctatttagtttttaaaataaagatactaaaaactgaaga  c.1314+60

         .         .         .         .         .         .  g.62929
aatacagtagctgtcatgaaatggatgcaggcttgtattgtttgactttgagaacgttta  c.1314+120

         .         .         .         .         .         .  g.62989
aatgcttgttaccctgccaggaatctttttgaaataaccaataatcttttaaaaataaaa  c.1314+180

         .         .         .         .         .         .  g.63049
atattcttttatctgtatttgataaaggttgagaatttgtcagtggttttaaataaagat  c.1314+240

         .         .         .         .         .         .  g.63109
gcaaacagtaaaatcataaggaatgtctattgaaagagagtaaagacatctgtaattggt  c.1314+300

         .         .         .         .         .         .  g.63169
ttcttcatagatttaatagaaagcaaaaacctccagtgtcaggagaattaattcacttga  c.1314+360

         .         .         .         .         .         .  g.63229
ttatttataaagacctgtaataattattccagagaatttataactcttcagaaggattag  c.1314+420

         .         .         .         .         .         .  g.63289
taacctttttagtttttgagttggaaactacaactccttctattatcttaatgacagttt  c.1314+480

         .         .         .         .         .           g.63348
tctaatcgtggatttcttgggaagcattattgagttgtagattataaagctttgttttt  c.1314+539

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.63407
 ttagtctataaaaaccaagaaaacagctttgcctttgagtgcttaaggttccagttttg  c.1315-481

.         .         .         .         .         .           g.63467
aaacaatattgttagtgtgccttatttttgtatttgcaatattaaaattgtcaaattaaa  c.1315-421

.         .         .         .         .         .           g.63527
taaattgtattaaaggtttgtatgaaccgccaaaatacacattagctgtatttattatat  c.1315-361

.         .         .         .         .         .           g.63587
catgaaattaagttgccaggttttagatggcagttctaaagcattttataatgttagaat  c.1315-301

.         .         .         .         .         .           g.63647
ttttttttttttttttgagatggagttttgttctgttgcccaggctggagtacagtggct  c.1315-241

.         .         .         .         .         .           g.63707
cgataccggctcactgcaaccttggcctcctgggttcaagtgattctcctgcctcagcct  c.1315-181

.         .         .         .         .         .           g.63767
cccgagtaggtgggattataggcatttgccactgtgcgggctgtgttaggaattttcttg  c.1315-121

.         .         .         .         .         .           g.63827
tgttacatagttaaatgaaggagataggagtactttattaattgtcagcaagcagtatac  c.1315-61

.         .         .         .         .         .           g.63887
actacttaatctattactcagattcttgtgcattgtgatttcgtttttgtttttcaatag  c.1315-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center