ubiquitin specific peptidase 9, X-linked (USP9X) - 2994 nt intron 15 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.82303
gtttgttttatacagttagtgttgctctctttaagaaaaagataaggaatacagaatgaa  c.1985+60

         .         .         .         .         .         .  g.82363
tagactgtatagcttggtctttgttgggtggccttttcccaagtccccaagtcatgtaag  c.1985+120

         .         .         .         .         .         .  g.82423
acatttccctgtatttgttactaaatactttaaaatgattcgctgagttttaactttgtt  c.1985+180

         .         .         .         .         .         .  g.82483
gcaatattttaagagaacacattttaacctttagaattgacttcgttcttcatatctgtt  c.1985+240

         .         .         .         .         .         .  g.82543
tatgctggaaataatgtttatttttaaagggcaaattcccatattttgacacaaccggaa  c.1985+300

         .         .         .         .         .         .  g.82603
ggaggactatactgacttaatgatatcatagacactaaggaaacgggggcaaaaggctgc  c.1985+360

         .         .         .         .         .         .  g.82663
tagaccagcacctcaaaagagtggttggagtcctctggtatcttgtttattctaacagtg  c.1985+420

         .         .         .         .         .         .  g.82723
gctgacaggcaatctaaagtcatgtgttaataatatcatttctgattggcttgaggggaa  c.1985+480

         .         .         .         .         .         .  g.82783
aaggtttattaagataaaatgtagtctagggctggattttctctgcaatatttagcgttt  c.1985+540

         .         .         .         .         .         .  g.82843
ggtgatcatacacttaacagatgtgcaaagtgcctttgttaaaaattttgatggtcaggc  c.1985+600

         .         .         .         .         .         .  g.82903
acggtggctcacacctgtaatcccaacacttggggaggccaaggcaagtggatggtttga  c.1985+660

         .         .         .         .         .         .  g.82963
gcccaggagttcaagaccagcctgggcagcatggcgaaatcccatctctaaaaaaaaata  c.1985+720

         .         .         .         .         .         .  g.83023
caaaaatcagccaggcatggtggtgttcacctgtagtcccgggtactcgggaggctgggg  c.1985+780

         .         .         .         .         .         .  g.83083
tgggaggatcacttcaacctcggaggcggaggttgcagtgagctgtgattgcaccactgc  c.1985+840

         .         .         .         .         .         .  g.83143
actccagaccctgtctcaaaaaaaaaaaaaaaattttttttttaaatgagaggttccttt  c.1985+900

         .         .         .         .         .         .  g.83203
tgaattcaaaaaaccacatgtagcaaaagagcttgtttagattacaagtgtgctaacaga  c.1985+960

         .         .         .         .         .         .  g.83263
aatgcccagattatcactgcttcttgaagtctattttatttatttatcttatttttttga  c.1985+1020

         .         .         .         .         .         .  g.83323
gacggagtctcactctgtcgccaggctgaagtgcagtggtgagatctcagctcactgcaa  c.1985+1080

         .         .         .         .         .         .  g.83383
cctccacctcccaggtacaattctcctgcctcagcctcccaagtaactgggactacaggc  c.1985+1140

         .         .         .         .         .         .  g.83443
atgcgccaccacgcccagctaatttttgtgtttttagaagagacggggtttcaccatgtt  c.1985+1200

         .         .         .         .         .         .  g.83503
ggccaggatggtctctatctcttgacctcgtgatctgcccgcctcggtcccccaaagtgc  c.1985+1260

         .         .         .         .         .         .  g.83563
tggtattaaggtgtaagccaccgtgcctggccccatttattttaataacatattctgggt  c.1985+1320

         .         .         .         .         .         .  g.83623
agttttgtcctgggctgtgttaattatggatttctatttattgaactctgtgcttattta  c.1985+1380

         .         .         .         .         .         .  g.83683
tggagaaaattttaagtagctatataatgattttgaggaaaaacctctaccaaattttaa  c.1985+1440

         .         .         .         .         .         g.83740
gaaatttggcatttgtttaaagtgcattgtttttttttttcctgtgtgttttgtttt  c.1985+1497

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.83797
   taaccacctggatagaaggacttgcctcctccccacattgagagttactgccatagt  c.1986-1441

.         .         .         .         .         .           g.83857
aagcagtcgttactgattggcatgtgttatatgtctcttaggtttactagaacagaaaag  c.1986-1381

.         .         .         .         .         .           g.83917
tggtttcaagcctttttgccattttaaagtttggaatcagaggaactattgtagtttcta  c.1986-1321

.         .         .         .         .         .           g.83977
ctctgttagtacctctgtatgtgagctaatagcaactaactcaaggaagaggaacctgac  c.1986-1261

.         .         .         .         .         .           g.84037
tttaatgcctgctgtgtgttgggcctgtgccagacactttatatttactccgaagcaaca  c.1986-1201

.         .         .         .         .         .           g.84097
cagtgcagcaggtgttactcccatctgatcagtaagaaacccaagattccaatggcttaa  c.1986-1141

.         .         .         .         .         .           g.84157
ggtagcttgtttgaaatatcacagccagtatacgatggaattgcactactcaactaggtc  c.1986-1081

.         .         .         .         .         .           g.84217
tcttttacttaagtctgtgctcttcctattagaccggtagtttttcaaacttacgtagga  c.1986-1021

.         .         .         .         .         .           g.84277
gctttagggcttctgagttaagttccttgaagatttctgaacaagcagtaggaagtttcc  c.1986-961

.         .         .         .         .         .           g.84337
cgatttttcctttctttttcctctcccaacaactggtgcagctctactttttaaaatata  c.1986-901

.         .         .         .         .         .           g.84397
tatcagattccaaatgggattttcatttgaagaagggtctatgccatctttagaaaaaaa  c.1986-841

.         .         .         .         .         .           g.84457
caaaaaaatggaaaacctttgaaaagttaagcagttttaactcataaatattgatggatt  c.1986-781

.         .         .         .         .         .           g.84517
agttatttgtgaaagtcacttgattgaatacctcatttttcaatgatgccatataagcag  c.1986-721

.         .         .         .         .         .           g.84577
gctgctaagtcttttttctggttgttgttgttggagacagggtctcacccaggattctct  c.1986-661

.         .         .         .         .         .           g.84637
acttaaatatgactgttgttaattgagtgctacaattaaattagccattgccatctttaa  c.1986-601

.         .         .         .         .         .           g.84697
ttggagtgcagcggcacagtcttggctcactgcaacctccgcctcccgggttcaattgat  c.1986-541

.         .         .         .         .         .           g.84757
tctcatgcctcagtttccccagtagctgggactacagacatgagccaccacacccggcta  c.1986-481

.         .         .         .         .         .           g.84817
atttttatatttttagtcaagatggggttttgccatgttggccaggctggtcacaaactc  c.1986-421

.         .         .         .         .         .           g.84877
ctgacctcaggtgatccgcccacctcagcctcccaaagtgctggcattacaggcgtgagt  c.1986-361

.         .         .         .         .         .           g.84937
tactgtgcccagcctaagtcttttatttttaactcaagctactaaacatgcttctttcca  c.1986-301

.         .         .         .         .         .           g.84997
aaagtctggtttcaaaaactaaaggttcatggaatgaatcttttattcctaattcagcta  c.1986-241

.         .         .         .         .         .           g.85057
gctgcatttcaggcacaaagtgggtgttcagtgtgtgcttgttgaattaattaatatcta  c.1986-181

.         .         .         .         .         .           g.85117
gtggggatttttttttagtaccagataaaagtagagaaataggttattttgaaagaatga  c.1986-121

.         .         .         .         .         .           g.85177
atatctttttatctatagttaaaatataatggtgataaatgtattttataggtaatacag  c.1986-61

.         .         .         .         .         .           g.85237
attgcctttccggataaaaattacataaatctaattgccaattttcaatgttttttcaag  c.1986-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center