ubiquitin specific peptidase 9, X-linked (USP9X) - 1267 nt intron 16 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.85640
gtaagtcaaaagtaggaactctgtaaatggtgtctgatgtactttttcatgtacgtaagg  c.2328+60

         .         .         .         .         .         .  g.85700
aattgtaattttgcatataaattgtgtattttactctgatgtttgtctcaggaatttggt  c.2328+120

         .         .         .         .         .         .  g.85760
gtagttaggaattgttcatttttattatgtcacctgtcagtgggctttttcttctctctt  c.2328+180

         .         .         .         .         .         .  g.85820
cctctccctcctcctgccactgatgttccttttgtcttagcttagtatctgtgtattcca  c.2328+240

         .         .         .         .         .         .  g.85880
tagatgtgcactaaacatacaaatctttcattcctcccccgtggatattaatgttccttc  c.2328+300

         .         .         .         .         .         .  g.85940
ccgagttttcattcagtgtcgatctgtttcctcctcttcaatgtttaacactaaaataga  c.2328+360

         .         .         .         .         .         .  g.86000
ggacagaagagaggacttgtgtttagtatagattatgagtatatgctttattggcactgt  c.2328+420

         .         .         .         .         .         .  g.86060
ttaccttgtgatatttttaaatacctgggggaataaaatactatctttttaaggctaatc  c.2328+480

         .         .         .         .         .         .  g.86120
tatttttatagtactactctattatgcctatctttaatctgacctgttatacagcagttt  c.2328+540

         .         .         .         .         .         .  g.86180
atattgtttggatgtctcacatattttcctgcaaaccatagataaagatgtttattgtgg  c.2328+600

         .         .         .      g.86214
catttgagtatttaaaagcttttaattaagtatg  c.2328+634

--------------------- middle of intron ---------------------
               g.86215        .         .         .           g.86247
               c.2329-633  tggttttcaacattgttttaacagcagaaacac  c.2329-601

.         .         .         .         .         .           g.86307
atcttaaaactcaaaatttgcaccacactacaaaagtaaactgaattgaacaaggaaaat  c.2329-541

.         .         .         .         .         .           g.86367
atgttttcttacttggtctccccatgcttatcccctttcccctccccaacccttttatag  c.2329-481

.         .         .         .         .         .           g.86427
gggccaacactgaaacacttcctcaaagtcccctagggttctgaacatagtttggaaacc  c.2329-421

.         .         .         .         .         .           g.86487
actaatgtaattagatgagtgataaagatttatagaaactgggggtagagtagtccttta  c.2329-361

.         .         .         .         .         .           g.86547
tgctaaactgtgtttcatgtaatctcttatttcctgtcaactaatttgaatttcttcttg  c.2329-301

.         .         .         .         .         .           g.86607
agtgtctcacttggttatcaagatattaaattatagggttaaataatagtggtcaaagcg  c.2329-241

.         .         .         .         .         .           g.86667
tattttatttttacaaaaatgtacctttcattcttaaattattcagagactttcattttg  c.2329-181

.         .         .         .         .         .           g.86727
catttattaccctttcttttggtctgtgcttctcacttaattttacttgattatcaaagt  c.2329-121

.         .         .         .         .         .           g.86787
caacttaccattaaatcattgaatagtgtgtttaagataactgaggatatggtttgaatt  c.2329-61

.         .         .         .         .         .           g.86847
taaatgcccaacaaaaatatatgttgaaagggatgaatacttttatcattttgaaaccag  c.2329-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center