ubiquitin specific peptidase 9, X-linked (USP9X) - 234 nt intron 19 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.89661
gtatgtatgtatagttaacagatttttcaataaaatcaaaccagagactatcgtttaatc  c.2877+60

         .         .         .         .         .         g.89718
agtaaatactaattgagcatttgttatgtttgggactgtgttaggtgttagagttat  c.2877+117

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.89775
   agcattaaagtatagcatgtagtctttcggattttttggttggtatatcactaagtt  c.2878-61

.         .         .         .         .         .           g.89835
ttgtgttttgtgtaagtatttttccttgtttttgatattaacatagtatataattttcag  c.2878-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center