ubiquitin specific peptidase 9, X-linked (USP9X) - 1218 nt intron 20 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.90045
gtgagtagatacagttttgaactactgtatgtaaggcatcatgctagggtttttgagaat  c.3027+60

         .         .         .         .         .         .  g.90105
aaagtatatagagtggttctttcttttcttgaggagcttacagtttaatgagacaaaaaa  c.3027+120

         .         .         .         .         .         .  g.90165
atacagttaaccaccaacttcagaatggatccctctaaaaggtaattgtaacacagttgg  c.3027+180

         .         .         .         .         .         .  g.90225
aatttaaaacataatttccccataggtatagtattgttacttttacataaaattaaccaa  c.3027+240

         .         .         .         .         .         .  g.90285
ttagagcttaattataacactattggatgtataaatttagaggaaaacagtcatccctcg  c.3027+300

         .         .         .         .         .         .  g.90345
tatacgtggagaattggttccaggacctctgcatatacccaaaatgctgcagatgaccct  c.3027+360

         .         .         .         .         .         .  g.90405
gtgcaaccagatatacaaaaagttagccttccatatacttgggttttgcttgctggaaat  c.3027+420

         .         .         .         .         .         .  g.90465
actgaattttctgtccacatttgattgggaaaaaagtctgcatgtaaatggacctgtgca  c.3027+480

         .         .         .         .         .         .  g.90525
gttcaaacttgtgttgttcaagagtcagctgtatcactttctaaaatttataccacaaaa  c.3027+540

         .         .         .         .         .         .  g.90585
cggatagttcttttagaactatatatgagctgggcatggtggctcacacctgtaattcca  c.3027+600

           g.90594
gctactggg  c.3027+609

--------------------- middle of intron ---------------------
                                       g.90595                g.90603
                                       c.3028-609  gaggctgtg  c.3028-601

.         .         .         .         .         .           g.90663
aggcaggaggattgcttgagcccaggagttctaggctgcagtgagctgcgattgtgccat  c.3028-541

.         .         .         .         .         .           g.90723
tatgctctagcctggtcaacagagtgagaccccatctctaaaaatataaataaatgaaaa  c.3028-481

.         .         .         .         .         .           g.90783
caagaactatgtaggaaaatacctgtaatctttatcagattgtcagtaacatatagccaa  c.3028-421

.         .         .         .         .         .           g.90843
agaaatatttttaagctctcctttcgcccctcccgacagaaattttaatggttacaatag  c.3028-361

.         .         .         .         .         .           g.90903
tagcagccactccagtgtcaggaggatttggctctctataacaactggattaagaatttg  c.3028-301

.         .         .         .         .         .           g.90963
gtagtgggcatggcagccttttgttatgtccagagtctaaattgtatatatgagagaaat  c.3028-241

.         .         .         .         .         .           g.91023
ggtttaatagaacaggagaggagctatcacaaaaaaatgactggaagtgacttgatgatg  c.3028-181

.         .         .         .         .         .           g.91083
tatttgatctgcactattaaggatttgtagggattaaaagatgggaaagtcagactattt  c.3028-121

.         .         .         .         .         .           g.91143
caaagagtagaaatttcataagtaaaagtatagggattaacacagagaaacttacttggg  c.3028-61

.         .         .         .         .         .           g.91203
cttttataaaacgggagtaaataatttagaggtaattattttgtgtattttatattctag  c.3028-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center