ubiquitin specific peptidase 9, X-linked (USP9X) - 268 nt intron 22 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.103554
gttagtttttggggttttttgttgttgttgttttctttgtttttccttttaaatttattc  c.3279+60

         .         .         .         .         .         .  g.103614
tgtgttctttaaatttgacctttcatatggtaaggtgaatgatttgggtaaaattgtaat  c.3279+120

         .      g.103628
gaagtagttttgaa  c.3279+134

--------------------- middle of intron ---------------------
                                  g.103629        .           g.103642
                                  c.3280-134  atgaaatattaatt  c.3280-121

.         .         .         .         .         .           g.103702
tgaaataaataatagtgagatggtcaagagtttcttggcactgacaatagtacaaataga  c.3280-61

.         .         .         .         .         .           g.103762
agttattttttttttaaatcttttaatacagccctctccccctcttctctatttttccag  c.3280-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center