ubiquitin specific peptidase 9, X-linked (USP9X) - 1841 nt intron 23 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.104101
gtaatacagactttttaaaaatccttttataatagtagatagcaatttttaaagtaaaac  c.3558+60

         .         .         .         .         .         .  g.104161
taattagtattttaagtgtagagttcaaggttgactcaatgttcaaagtgccttatttca  c.3558+120

         .         .         .         .         .         .  g.104221
gaggttttctttatgatgtttgtattaaaagtgcaaatacttttcgctgacagctgataa  c.3558+180

         .         .         .         .         .         .  g.104281
tctgagggtagtttctccctgcccacttaaatcttgcttgactttcatttattttaaacc  c.3558+240

         .         .         .         .         .         .  g.104341
taacaaaaactccatatgaatctcttattaacttgtgcctggtagatatataaagacaca  c.3558+300

         .         .         .         .         .         .  g.104401
gattgtaataagagatataattggtttatcttgttgcttgtttcccttcccaccttgggc  c.3558+360

         .         .         .         .         .         .  g.104461
ttaaacccaagttctgagcttattctgactcggtttctgccttggtggcattcttgatcc  c.3558+420

         .         .         .         .         .         .  g.104521
atgtcacaaaaaattctcaagacatgccagaatttgatacttatttatgagagatcaaac  c.3558+480

         .         .         .         .         .         .  g.104581
tatgcatttaattctaagtaaagttttataaacatcataaatgattgttttactaagtta  c.3558+540

         .         .         .         .         .         .  g.104641
ctgatagaaggtaaaacttcagggataaagattttcttctttagaaatggcttagttttc  c.3558+600

         .         .         .         .         .         .  g.104701
aattgtggagatcagaatgttgatatttatggtaatatcacatataattgttttagctat  c.3558+660

         .         .         .         .         .         .  g.104761
gataatactgtggttatgtttaaaaggaagagccccctatatttttgaagtgattgctaa  c.3558+720

         .         .         .         .         .         .  g.104821
gatacttccaggtgaaattacatgatatctaggatttgcttaaaaacaatcctggggtgg  c.3558+780

         .         .         .         .         .         .  g.104881
agaagtgatggaaagcaagggaggatagtcagattaaacaatttggttcactggcgataa  c.3558+840

         .         .         .         .         .         .  g.104941
ttcctgaagctaagtaatatgtacatgggagttaattatactactttcgacactttgatg  c.3558+900

         .         .   g.104962
tgtgttacgaattttctgtaa  c.3558+921

--------------------- middle of intron ---------------------
                            g.104963    .         .           g.104982
                            c.3559-920  aaaatggcttaaattttata  c.3559-901

.         .         .         .         .         .           g.105042
ttgttttgtatcacaggtcccatctttgttaggatttttttttttttaaagtagttctta  c.3559-841

.         .         .         .         .         .           g.105102
ttaggtaagtaaaaagacagcttcttgttaggataaaaacagatttttgtcatgatccct  c.3559-781

.         .         .         .         .         .           g.105162
gacacagatacttaatgaagtacacagaaaacaattacatgtttccactttcacctttct  c.3559-721

.         .         .         .         .         .           g.105222
tcagtatttattcagagaatgtgccactatggatacagaggtacataataacctctaatc  c.3559-661

.         .         .         .         .         .           g.105282
tcaacgagctcacagtagggagcccaatgcaaacttagtaatatagaaatatcttaaaat  c.3559-601

.         .         .         .         .         .           g.105342
aatattgttgaaatatttacagtatatatatataggaggggagttacaacttgaaggcag  c.3559-541

.         .         .         .         .         .           g.105402
tcagaattacctcgctaacaactacgtaatgaaattaatctgtcactgatttaacaactt  c.3559-481

.         .         .         .         .         .           g.105462
gattatagcattaagtaaaaactagggtacctttcatacattagtcctcttactgctttt  c.3559-421

.         .         .         .         .         .           g.105522
tcagtattccttaatttttcttttttttttccaaagaaaaatgtggtaacaatggggaat  c.3559-361

.         .         .         .         .         .           g.105582
acaagcagggtctgcccaaggcatgtacataaaagatgtacaatactttactgagtctct  c.3559-301

.         .         .         .         .         .           g.105642
agaagggaaccagtctatttagtgtatcattatcccctgcaagttaagctgaggccagat  c.3559-241

.         .         .         .         .         .           g.105702
ttagagacacgagttgattgctctagaatggggatttgcagacacgtggcactacagtgc  c.3559-181

.         .         .         .         .         .           g.105762
acaaggaagagaggaagcccactttgttggcagtgctttttgtgtaagttgccacaggtt  c.3559-121

.         .         .         .         .         .           g.105822
ctataatgtgtatatgcaaggaagtcgttctgcaggagtgggtgatgaatgaagagcaat  c.3559-61

.         .         .         .         .         .           g.105882
tggttaggtctggttatgtacaaattatttactccaaataaaatggttaacttttttcag  c.3559-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center