ubiquitin specific peptidase 9, X-linked (USP9X) - 1191 nt intron 25 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.107543
gtaagaattatcacagaactatattccttgtaaacaaatgtttcttaattgtgcatgtgg  c.3810+60

         .         .         .         .         .         .  g.107603
tttgatttttattagctttgctatttttaaaaattgaatcacttgcatcttaatggttga  c.3810+120

         .         .         .         .         .         .  g.107663
aaattaattgatagctatgttgagaatatggtaaaattttactttgaaaatgaagtactt  c.3810+180

         .         .         .         .         .         .  g.107723
aagaatcgtgccatgtggctgctttttaaatgaaattgccttttgctgcttcttgtgggg  c.3810+240

         .         .         .         .         .         .  g.107783
gtcagatataattgtctcatactgaatttgctttatcccattctcttttttcttttatca  c.3810+300

         .         .         .         .         .         .  g.107843
tctttctgtcctgcgtaaattttggtttgtcagttatggtatggcatttaagtattttta  c.3810+360

         .         .         .         .         .         .  g.107903
tttgattgtcttaaagcagtcaaaaataagagtgttagccaattagatatcattcctgac  c.3810+420

         .         .         .         .         .         .  g.107963
cttctattagattaagcaaattatctacagaagagaagctgtggttggctttttgattta  c.3810+480

         .         .         .         .         .         .  g.108023
tcatgtgtacctgcccctgatgctacatatttagaaggagaaattgagttacaggaactt  c.3810+540

         .         .         .         .         .        g.108079
ccctgacttggtagagcttcttttacatggccaacatcaccctgatttgcccagga  c.3810+596

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.108134
     tatatgttgatgttccatagtatctgtctggcacagccctgggtattcattcagc  c.3811-541

.         .         .         .         .         .           g.108194
ttattaactgaatacttattctgtttcaggcatgtactgtagttactactttttgattaa  c.3811-481

.         .         .         .         .         .           g.108254
taaagtcagattagaattcattaggtacctccccaggcatattttaggttgtaagccttt  c.3811-421

.         .         .         .         .         .           g.108314
gaaacccttcctgaatagttgtcagacaattgattttgaataaaatggcacaataggcaa  c.3811-361

.         .         .         .         .         .           g.108374
gcaacataatggaactagtcaaaagtacctaagtgctatgccacagtggttcctgagaaa  c.3811-301

.         .         .         .         .         .           g.108434
ggattggttgttggttcagaagtaaacaactcagaaggtctcaaaaagataggtagtgtg  c.3811-241

.         .         .         .         .         .           g.108494
ctcagtgtgctccttcagccctcctgaagacataggaaaataatggaattagactttatt  c.3811-181

.         .         .         .         .         .           g.108554
ttctattatagtcatttccagactattccaaaggggcctcaagagttaacatgcagccat  c.3811-121

.         .         .         .         .         .           g.108614
ggagaggctgaggccaggtggtttaagtgagcagatgagttttaagcactaactagaagt  c.3811-61

.         .         .         .         .         .           g.108674
tgtgtgagatttttcttaaatacttctttgggtaatttgttcttgattgtaattttacag  c.3811-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center