ubiquitin specific peptidase 9, X-linked (USP9X) - 232 nt intron 27 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.115785
gtgagactttttaaaatatgcttatcaatgtgattcattctttaagcaagaaacattcag  c.4086+60

         .         .         .         .         .        g.115841
aaatttgtggttttagcttgcattaaagttaggacagtctatatttaataaatgaa  c.4086+116

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.115897
    gtactactttatttcccgcactgtggtagtcatcttctctagttaactctgggttt  c.4087-61

.         .         .         .         .         .           g.115957
ttaaaaaagtggattttgaggatggacgtgtaaattgatattattctactctgtttccag  c.4087-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center