ubiquitin specific peptidase 9, X-linked (USP9X) - 1017 nt intron 29 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.116936
gtaagttctgtgttcttggttgtaagctacatatcataaccttctaaatgtttataatca  c.4380+60

         .         .         .         .         .         .  g.116996
aatttaattaatttatagtagtatcatgtctttgtactttcttgatcttttctctttttt  c.4380+120

         .         .         .         .         .         .  g.117056
aagaatctttatcaaatttacagtaatttaagaaatacagttatgccttactttattcaa  c.4380+180

         .         .         .         .         .         .  g.117116
gagacatttctaaatttgtatttaaataagatttcatggctggacttgctggcctcatgc  c.4380+240

         .         .         .         .         .         .  g.117176
ctgtaatcccagtactttgggaggccgagtccagtggatggcttgagcccaagagttgaa  c.4380+300

         .         .         .         .         .         .  g.117236
gaccagcctgggcaacatggtgaaaccccttctctacaaaagaaaaaaaaaaaattgcca  c.4380+360

         .         .         .         .         .         .  g.117296
ggtgtggtggcgcacacccatggtccccagctacttgagaggctgagatggaaggatcac  c.4380+420

         .         .         .         .         .         .  g.117356
ctgagcccaggaggtggaggttgcagtgagctgagatcgcaccactgcactccagcctga  c.4380+480

         .         .           g.117385
aggaacagagcaaggccctgtctcaaaat  c.4380+509

--------------------- middle of intron ---------------------
                    g.117386            .         .           g.117413
                    c.4381-508  aaatagataaataaataagatactttat  c.4381-481

.         .         .         .         .         .           g.117473
aaagtaattgttgtttagtttttctctttggaaaatctgaattgttaatttcatttaatg  c.4381-421

.         .         .         .         .         .           g.117533
aggcaaacctctgttttgtaagaatgcatcttgtatatctttaatgagttttttcataca  c.4381-361

.         .         .         .         .         .           g.117593
tgtagtaacacaaggaaacaaagtttcatttttgtacattttatttctattcaaaatggg  c.4381-301

.         .         .         .         .         .           g.117653
tttaatttgctatacacttgattaaaggagcaaacatttaaaataaaaattttgataagt  c.4381-241

.         .         .         .         .         .           g.117713
actatattcagttctttcttaatatttacaaatttatttaacctgcgaaattaggtatgt  c.4381-181

.         .         .         .         .         .           g.117773
tagtgatagtaaatagtgttttgaaggaagatctttttattagaaaatctgagttttctg  c.4381-121

.         .         .         .         .         .           g.117833
agatgtaatgagatcttaaattccaatgagtaattttaaaatgatttacttacaagagaa  c.4381-61

.         .         .         .         .         .           g.117893
ctttttttttctaaaaatatatagcattgctaatatgtaatccctttttcaactttttag  c.4381-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center