ubiquitin specific peptidase 9, X-linked (USP9X) - 4022 nt intron 31 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.120706
gtaaatttgagttaccatttctgttttctgtgtttcaagttatgataccagatactattc  c.4824+60

         .         .         .         .         .         .  g.120766
tctcttaagagagtgttatactttcatcaaacgtattaaagtatatttgaaagttaggga  c.4824+120

         .         .         .         .         .         .  g.120826
tgggccgagcacacacctgtggtctcagctactcaggaaactgaggcaggaggattgctt  c.4824+180

         .         .         .         .         .         .  g.120886
gagcctgggagctggaggctgcagtgagccatgatcatgccactgcactccagcctgggt  c.4824+240

         .         .         .         .         .         .  g.120946
tacagagtgagaccctgtctcagaagaaaaagaaaaagtaagtagggatggacttctccc  c.4824+300

         .         .         .         .         .         .  g.121006
agccagcatgaactgctacctcttaacatagtatagttctcactacctaccagaatttaa  c.4824+360

         .         .         .         .         .         .  g.121066
actgcagataatttttagaatggtttgtacatttctaaagcaacagttggctgggcatgg  c.4824+420

         .         .         .         .         .         .  g.121126
tagctcacacctataatctcagcactttgggaagctgaggcaggtggatcacctgaggtc  c.4824+480

         .         .         .         .         .         .  g.121186
aggagttcaagaccagcctggccaacatagtgaaaccccatgtctactaaaaatacaaaa  c.4824+540

         .         .         .         .         .         .  g.121246
attagctgggtgtggtggcacatgcctgtagtcctagctactcggaaggctgaggcagga  c.4824+600

         .         .         .         .         .         .  g.121306
gaatcacttgaacccggaaggtggaggttgcgatgagctgagatggcaccagtgcactcc  c.4824+660

         .         .         .         .         .         .  g.121366
agcctaggtgacagagcgagactccgtctcaaaaaaaaaaagcaacagttaatgtactcg  c.4824+720

         .         .         .         .         .         .  g.121426
tgtttttttgtgtagagtgtttagtataatttggggtttgtttgatggtaagaaccttca  c.4824+780

         .         .         .         .         .         .  g.121486
tttttgataatagttttaaatttttacttttctatttctaaattttaattttctatttta  c.4824+840

         .         .         .         .         .         .  g.121546
tgccaagttatacagtatctgccaatttcactgtgtgtgcttacttttaggttattcttt  c.4824+900

         .         .         .         .         .         .  g.121606
gaatttcccttagatcatagctcttcttgattaggaaacaaactttccctactttaaata  c.4824+960

         .         .         .         .         .         .  g.121666
gtctcacgtagtcttgtggcaaaatttaggctgcctactgagtatccagtgcagtataaa  c.4824+1020

         .         .         .         .         .         .  g.121726
gcagtgaagaagttgagttgtagtggcgaatcagaattgacataactgtaagatagctct  c.4824+1080

         .         .         .         .         .         .  g.121786
ttaaagaagagcatatggcaagaagacttaagttgtggtcatgtttgtgcttaccatgta  c.4824+1140

         .         .         .         .         .         .  g.121846
atatttccttggttttacttttcctgtttatagtgatagtgggaactgaagagagaagcc  c.4824+1200

         .         .         .         .         .         .  g.121906
agagtatattctaattgtagtaaatggttcttttcattccctcccttcagttgccagaac  c.4824+1260

         .         .         .         .         .         .  g.121966
tgattttgctctgaagaagtagtttatcaattggagcttctgaaacatctacttgcctca  c.4824+1320

         .         .         .         .         .         .  g.122026
actcttccctagacctgctgtgccagatggtctagggattgggttctgagcactttcact  c.4824+1380

         .         .         .         .         .         .  g.122086
ttataaaaaaaagcttcataaaggacacttatacccatacctgattaaaaaccactgctc  c.4824+1440

         .         .         .         .         .         .  g.122146
tgggaaaaaaatgtaattcaaattccagttctggagcccatcatatacctgggatattga  c.4824+1500

         .         .         .         .         .         .  g.122206
gttaaacacaagtagatataggtaattgtactggcaagaagtaaatgaggcatagaaaat  c.4824+1560

         .         .         .         .         .         .  g.122266
ataacacaatttcaaataaggtgtaccacttttactctcatggtatcctctgctccatgt  c.4824+1620

         .         .         .         .         .         .  g.122326
tgtctctgcaccccagtgtactgtgggagtttttgtggggttttttgggttttggttttt  c.4824+1680

         .         .         .         .         .         .  g.122386
ttggcttatgtttttgtttccatccctagagtataagtttctcatgggcagggactggtt  c.4824+1740

         .         .         .         .         .         .  g.122446
gttgtctatttctatatcagagttatcagatacaactcagagaatactgaaagatagtta  c.4824+1800

         .         .         .         .         .         .  g.122506
aatgtaaaaacacattcttctttgtagctgccatatgattatgacctttaggaattctgt  c.4824+1860

         .         .         .         .         .         .  g.122566
cttcatgttacatcttacaccactacttctgttgttttttaaaattgtggtaaaatacat  c.4824+1920

         .         .         .         .         .         .  g.122626
ataacatgaaacttaccatctgtttttaaatgtgcagttgtcctattaaatacatttaca  c.4824+1980

         .         .         .   g.122657
ttgttgtacaccatcaccaccacccatctcc  c.4824+2011

--------------------- middle of intron ---------------------
                g.122658      .         .         .           g.122688
                c.4825-2011  aaaactcttcatattgcaaaactcaaactgt  c.4825-1981

.         .         .         .         .         .           g.122748
agtcattaagctactccccattctccctccccacagcctctggcaactactattcttttt  c.4825-1921

.         .         .         .         .         .           g.122808
gtctctatgattgactactctacatacctcatataagtgattatataagtgaaatcatac  c.4825-1861

.         .         .         .         .         .           g.122868
agtgtttgcctttgcatagctggcttatttcattttaaagtctaagtaatattccattat  c.4825-1801

.         .         .         .         .         .           g.122928
atgtatataccacattttccttatccattcatttgtcgatggacatttgggttgcttccc  c.4825-1741

.         .         .         .         .         .           g.122988
catttgagctattgtgaataaggctgccatgaacatggatatacaaatagctgtttgagg  c.4825-1681

.         .         .         .         .         .           g.123048
tcctgctttcaatatttccaggcatatgctcagaagtggaagtactagatcatttggtga  c.4825-1621

.         .         .         .         .         .           g.123108
tgctatttttattttattatttattatttttttcagacagagtctcactctgtcacacag  c.4825-1561

.         .         .         .         .         .           g.123168
gctggagtgcagtggtgctatctcagctcactgcaacctctgcctcctgggttcaagcga  c.4825-1501

.         .         .         .         .         .           g.123228
ttctcctgcctcagcctcccgagtagctgggactacaggcacgcaccaccataccccgct  c.4825-1441

.         .         .         .         .         .           g.123288
aatttttgtatttttagtagagatgggatttcaccatattggccaggctggtctcgaact  c.4825-1381

.         .         .         .         .         .           g.123348
cctgatttcaggtgatccacccaccttggcctcccaaagtgctgggattataggcatgag  c.4825-1321

.         .         .         .         .         .           g.123408
ccaccatatgcggccaaattttttgaggaactgttttctagagtgactgcaccattttac  c.4825-1261

.         .         .         .         .         .           g.123468
attcctaccagcattgcacaagagctccaatttctccatatccttgccaacacttgttat  c.4825-1201

.         .         .         .         .         .           g.123528
actcactcgttctggtagttgacaccctaattgagtgtgaggtagtatctcatggttttg  c.4825-1141

.         .         .         .         .         .           g.123588
atttgcatttaccaaatggttaacgattttgagcatctttagctgtgcttattattggcc  c.4825-1081

.         .         .         .         .         .           g.123648
acttgttgatcttctttgtctatttttaaattgagttgtgttgttgagttttaagagttc  c.4825-1021

.         .         .         .         .         .           g.123708
tctgtatgttctagatattaactccatatcagatatgtgatttgcagatactttcttttg  c.4825-961

.         .         .         .         .         .           g.123768
ttgcctgtacctctgatgtcatatccaagaaatcactgccaaatccagtgtcttgaagct  c.4825-901

.         .         .         .         .         .           g.123828
tttgccctatgttttttttttttttttaacagttctgtggttttagctcttacatttagg  c.4825-841

.         .         .         .         .         .           g.123888
attttgatccattttgagttaatttttgtatgtagtgtttcataagggctcaactttatt  c.4825-781

.         .         .         .         .         .           g.123948
cttttgcatgtggattatccagtttacccagcaccatttgtggaagagtactagtcatgc  c.4825-721

.         .         .         .         .         .           g.124008
accacataacaacgtttcagacaattacagaccatatatatgacagtagtccaatgagat  c.4825-661

.         .         .         .         .         .           g.124068
tataatgtcgtatttttactgtaccttttctatttttagatgcacagattcaccgttggt  c.4825-601

.         .         .         .         .         .           g.124128
ttgcagttgtctacagtatgtagtacagtaacatgctgtacaagtttacaacctaggagc  c.4825-541

.         .         .         .         .         .           g.124188
aattggctataccatctaggtttataggtacactatgatgttcacatgacaaaataccta  c.4825-481

.         .         .         .         .         .           g.124248
atgatgcatttctcagaatttatccctgtcattaagcaaagaatgactatactgatatag  c.4825-421

.         .         .         .         .         .           g.124308
gtatattttattgacagatctgagcattttatatacaacagctacacaaaggatatatta  c.4825-361

.         .         .         .         .         .           g.124368
cccccattcacacataaagaaacttgaagcctagaaagtttaagtagtttttacttgctc  c.4825-301

.         .         .         .         .         .           g.124428
aaagttacttggtttataagtggtagagcctgcatttatgtctagttcagtctaaattac  c.4825-241

.         .         .         .         .         .           g.124488
tatgctaatgctacactatattatctatctttcttacacatggtcagggttatttggtta  c.4825-181

.         .         .         .         .         .           g.124548
tgataactaatatgtgaaatggtggggataaacactaaataactaaaaatttataaattg  c.4825-121

.         .         .         .         .         .           g.124608
aaaagtgctttggaaatgagcataataggaatacaaatcatttgttcaataactgcttgg  c.4825-61

.         .         .         .         .         .           g.124668
catttgtctcaacgtattttattatactttagctcattggtgacattttttggtttctag  c.4825-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center