ubiquitin specific peptidase 9, X-linked (USP9X) - 1189 nt intron 34 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.134135
gtacgggctgtccagttttgtttaattttgattacatttaatggatttagaagaaattgg  c.5331+60

         .         .         .         .         .         .  g.134195
tttttttggttcatcctcacaagtcaccctatttttattttctcctactttggtatagtg  c.5331+120

         .         .         .         .         .         .  g.134255
gtagcagagaagtagtcaatatgataactaatagaaggtttggcaaggaaggaaaaaaag  c.5331+180

         .         .         .         .         .         .  g.134315
tagtgccaaaggggctaggtaaataagataaaaataggtaaataagagtgaataatttta  c.5331+240

         .         .         .         .         .         .  g.134375
aaagtcataacgtgatagcacattctcttatataagttacacagacactttccatctcta  c.5331+300

         .         .         .         .         .         .  g.134435
ccgagaaacaaattgccattgaacccctcaaagatacagagctgatagaggaaaacattt  c.5331+360

         .         .         .         .         .         .  g.134495
ctcctgtcatgtccaggattacttgtcaagaccaaaacatttgctgaaaccattaattac  c.5331+420

         .         .         .         .         .         .  g.134555
tttattgaaccacataagatttcttttagactagtcaagtggcccataagatttctttta  c.5331+480

         .         .         .         .         .         .  g.134615
tcacctatgttataaaaccatttattttggaaacttattagcagttctttgagagagatg  c.5331+540

         .         .         .         .         .       g.134670
attcacacgcattatagtaatgaataaggtgtatctttgggagctcccaaaccct  c.5331+595

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.134724
      ttcaccctcaagtcacttgtgttgttttggccttatgcaccacttagagaagtc  c.5332-541

.         .         .         .         .         .           g.134784
ctgaagtttaaagattgagattgtgggctgtaaagccatactgcctgccacctgcagctc  c.5332-481

.         .         .         .         .         .           g.134844
ctgagacctgaggcaagttacttgacctctctgtgattactagttttcatcttttaaggt  c.5332-421

.         .         .         .         .         .           g.134904
tcagtagtacacacttgagaaggttgtaaggattcggtatgtttttacttgtgcggcact  c.5332-361

.         .         .         .         .         .           g.134964
tagtatatattacctggcatctgaattacccaacaaatattagctactcttattgttatt  c.5332-301

.         .         .         .         .         .           g.135024
gtagttctttggtttgtgcataggaaaccaccttcgtgggaacaacagtaaacatcaaac  c.5332-241

.         .         .         .         .         .           g.135084
aggtaataatggctagataacaatgacagaaaccagtcaacaatttaccatttgcatatt  c.5332-181

.         .         .         .         .         .           g.135144
attaatttcagcatttaaatcagctgataggattatcttgattatgctcattgtcatgta  c.5332-121

.         .         .         .         .         .           g.135204
tttgtttatacttaaaaattcagataagtcttaatatcatttaaaagtttgcttggggtt  c.5332-61

.         .         .         .         .         .           g.135264
tttttttttttcctgtggattttaatagaacatctggtaactttgtcttgtttattttag  c.5332-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center