ubiquitin specific peptidase 9, X-linked (USP9X) - 1028 nt intron 36 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.136769
gtacattgctttggattttcattcctattatactaatgtttggtttgcttctttaataga  c.6209+60

         .         .         .         .         .         .  g.136829
ttgctttatgtttttctaaaccaagagaattttgtttgaagtttggaatatagaataaaa  c.6209+120

         .         .         .         .         .         .  g.136889
actctgggtcacaatagagaaatcatattaaaatagttacttagtctaaacatggccttt  c.6209+180

         .         .         .         .         .         .  g.136949
tgttattcagaagctgacttctgcttctattaccttgtatcatatctttgacatccctgc  c.6209+240

         .         .         .         .         .         .  g.137009
accaaagactacaagctgagactgggggacagtgactcacacctgtaatgccagcacttt  c.6209+300

         .         .         .         .         .         .  g.137069
gggaagccagggtgggaggattgcttgagctcgggagttcaggaccagcctaggcaacat  c.6209+360

         .         .         .         .         .         .  g.137129
agtgagacccccatctcttcaaagaagattttaaaaattacccaagtatggtggcgcaca  c.6209+420

         .         .         .         .         .         .  g.137189
cctgtaatcccagctactcggaaggctgaggtgggaggatcgctggagcctgggaggttg  c.6209+480

         .         .         .      g.137223
aagctgcagtgagccatgactgtgccactgcact  c.6209+514

--------------------- middle of intron ---------------------
              g.137224        .         .         .           g.137257
              c.6210-514  ccagcctgggcagcagagcaagaccctgtctcaa  c.6210-481

.         .         .         .         .         .           g.137317
acaaaaccaaagattacaagatgagactgaaaagtgtaagctacttatgaaatttattag  c.6210-421

.         .         .         .         .         .           g.137377
gttttagcttacctagattgaattctgacaccgattaaaagggtaaaaaattaaaatggt  c.6210-361

.         .         .         .         .         .           g.137437
tttcttaagtttctaattgtgaaagtatagaggccattatgatacattgatttaataatt  c.6210-301

.         .         .         .         .         .           g.137497
tttacttactcatttcaggaatatgtcaagataagggggtggtattttgtcattgaatct  c.6210-241

.         .         .         .         .         .           g.137557
aggaagagtttgttaatggatttttagaggacaagctttcacctgtttggtaactctgag  c.6210-181

.         .         .         .         .         .           g.137617
agaatagaccaagtcatagtatttatctattgttttaatattagaagcaacctttgctgg  c.6210-121

.         .         .         .         .         .           g.137677
ttctctccagcagtagaggaagatctttgtcttttttttttggttcaatgagactcatcc  c.6210-61

.         .         .         .         .         .           g.137737
ttttactatagagaacaagttattgacttaatagtcataggtttttttgttttattttag  c.6210-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center