ubiquitin specific peptidase 9, X-linked (USP9X) - 86 nt intron 40 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .     g.144371
gtaaaaggaaaataacatttgtatgtttataatttgatttgtt  c.6972+43

--------------------- middle of intron ---------------------
      g.144372      .         .         .         .           g.144414
      c.6973-43  attcctttcattaagttactcaccatgtcttacttgtttttag  c.6973-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center