ubiquitin specific peptidase 9, X-linked (USP9X) - 4115 nt intron 41 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.144563
gtggatactctttttgtgactggaaacaattaggcttgcccaggtgttagagttaactga  c.7061+60

         .         .         .         .         .         .  g.144623
aattgacagtcaccacattttttttaacctattggagttctagtgaatgttttatcttaa  c.7061+120

         .         .         .         .         .         .  g.144683
acctaggacaagggtaaataacaggttctccccttttcctcagaattttatttccttttt  c.7061+180

         .         .         .         .         .         .  g.144743
tattcttttttctcactgcctaagtttcatacttaataagcctgtttctttagaatgact  c.7061+240

         .         .         .         .         .         .  g.144803
tttttaattaaggaggagctagcttgggcatttggtaaatatttgaatttcattaatgat  c.7061+300

         .         .         .         .         .         .  g.144863
gcccgaggattattttatgattatattacatttgttttagaattagtcacttgaagcaac  c.7061+360

         .         .         .         .         .         .  g.144923
ttagtcattagtcacatgaagtataatagtatatgtaaaaagtcttcaggtaagtacggt  c.7061+420

         .         .         .         .         .         .  g.144983
ttccatttttcatggtacttatattctgtaaagtcaccacagacactgagttagcaaata  c.7061+480

         .         .         .         .         .         .  g.145043
ctgaaccattactcctaggaggaaatacagaattaggtttctataagcctctgtttacat  c.7061+540

         .         .         .         .         .         .  g.145103
ttttatcaaccagtcaatacataaccttgttgtatgtgtgtttctacttaaagtcattta  c.7061+600

         .         .         .         .         .         .  g.145163
atatattttgttgactcataaagttcacagccaacagctctgtaacttaagcctgaactt  c.7061+660

         .         .         .         .         .         .  g.145223
aagcttctcaatgcattctgcataaggcacatcacagccttcttgtggttaggaacatta  c.7061+720

         .         .         .         .         .         .  g.145283
gatagcacttcaacattatatacttgggtcattttaaacataaaaataaccagcaaaagc  c.7061+780

         .         .         .         .         .         .  g.145343
acaaatatgtggaaaatgtggcactaaatacaccatgaagaaggacacttgtttacagtt  c.7061+840

         .         .         .         .         .         .  g.145403
taagctgaaacaagagagaatgacactcttctggacttcagctaggaacgtttgtgttgg  c.7061+900

         .         .         .         .         .         .  g.145463
acaacttgatatttttgctgctctgtatatgtccacagatgacgaagaaagcaccttgat  c.7061+960

         .         .         .         .         .         .  g.145523
gattgattttgcagttataaataaagtttaggaagtaagcgaattcacaaatgtggaatt  c.7061+1020

         .         .         .         .         .         .  g.145583
catgaataatgaggggatcaattataattagtttttatgagaacttttagaatgttaact  c.7061+1080

         .         .         .         .         .         .  g.145643
tttttcccccgtaaaaactaaggttatccagcttaactggccctcaaactttcactagaa  c.7061+1140

         .         .         .         .         .         .  g.145703
tttttctatttgtttttgggggtttttttgtagtaaaagttgaatatattatctttaatc  c.7061+1200

         .         .         .         .         .         .  g.145763
ccaagagttatataatagatgataaattatggtattagttgacagcactgccaggtttta  c.7061+1260

         .         .         .         .         .         .  g.145823
gaacttcccttcccacatggaagatagtataatagtttgtttgggaaaacaattcaaagt  c.7061+1320

         .         .         .         .         .         .  g.145883
ctatgtcgcagtttgcctcccatctgccaaggtaataaaacaaacttaaaaacaagttct  c.7061+1380

         .         .         .         .         .         .  g.145943
gtaacaacaaaatgcttaaagagaagtaacaatctggagttttagtggggattgcgaaag  c.7061+1440

         .         .         .         .         .         .  g.146003
ccagaatttgcaacttagtattttcaaattatctccaaatttaccataatagatttcaaa  c.7061+1500

         .         .         .         .         .         .  g.146063
caaatactgtaaaaatagcattaaaccaaaaatcaattttcgtgagacacaaaagatagt  c.7061+1560

         .         .         .         .         .         .  g.146123
agctcagaattatagtcgtttattcaggcagtattcagtgcccttctaaatatgttcata  c.7061+1620

         .         .         .         .         .         .  g.146183
ggatttgaaagcttccttcagagtagattttaatgaaatctaacttttactattttcttt  c.7061+1680

         .         .         .         .         .         .  g.146243
tttaaaaatgctgtatttctgggcacagtggcttacccctgtaataagcactttgggagg  c.7061+1740

         .         .         .         .         .         .  g.146303
ccaaggcaggagaattgcttgagaccaggagttcaaggccagcttgaccaacatagcaag  c.7061+1800

         .         .         .         .         .         .  g.146363
atcttgcctctatttttttaaaaaagaaagtactgtaagcacttacagttttaaaccagt  c.7061+1860

         .         .         .         .         .         .  g.146423
taatcacatcttagctcttgtttgattagagcaagtgataatggcaaagacatacgtgct  c.7061+1920

         .         .         .         .         .         .  g.146483
agattaaatgtgggaattacacttttgtgtaatgagattagtaagatactgttaaatgaa  c.7061+1980

         .         .         .         .         .         .  g.146543
tcactggcccaaacgtgaaaataattttctcataatgagcttttagttcattcagtaaac  c.7061+2040

         .          g.146561
aatgttcaaatatttata  c.7061+2058

--------------------- middle of intron ---------------------
                              g.146562            .           g.146578
                              c.7062-2057  gagtgtctaccatgtgc  c.7062-2041

.         .         .         .         .         .           g.146638
ccagcactgcttggcatcaggtaataaggcaagtgaagatagtattaataaaaatggcat  c.7062-1981

.         .         .         .         .         .           g.146698
ttgagagcagttgatgctaatggggagaaaatatgatatggcagaaataatgatttagca  c.7062-1921

.         .         .         .         .         .           g.146758
cttcattgttacttgaaaaaactgaaggtaaaagcaatttatatgtagtgtttcagatga  c.7062-1861

.         .         .         .         .         .           g.146818
aacagcaagagggcctgaacatggttgatttgtctgaaatgattaagctttgcaaaattg  c.7062-1801

.         .         .         .         .         .           g.146878
ttgaagtaatctgttttgtttggaaatcatgaatgcatttgatggaggaaaaaaatctta  c.7062-1741

.         .         .         .         .         .           g.146938
ctttgactttaaacatactgttaagtaaaatacatagtgtatattagaatctttaaattc  c.7062-1681

.         .         .         .         .         .           g.146998
tcagtgtccaggttatgttttctaattgaggtaaaatttacataacaaaactcaccattt  c.7062-1621

.         .         .         .         .         .           g.147058
caaagtatacaattcagtgacttttagtacattcacaatgttgtatagccattaccacta  c.7062-1561

.         .         .         .         .         .           g.147118
tctgattccagaacttttttttttttgagagggagtctcactctgtcacccaggctggag  c.7062-1501

.         .         .         .         .         .           g.147178
tgcagtggcgcgatctcggctcactgcaagctccgcctcccgggtttacgccattctcct  c.7062-1441

.         .         .         .         .         .           g.147238
gtctcagcctcccgagtagctgggactacaggtgcccgccaccatgcctggctaattatt  c.7062-1381

.         .         .         .         .         .           g.147298
tgtatttttagtagagacggggtttcaccgtgttagtcaggatggtctcgatctcctgac  c.7062-1321

.         .         .         .         .         .           g.147358
ctcgtgatccgcccacctcggcctcccgaagtgctgggattacagatgtgagccaccgtg  c.7062-1261

.         .         .         .         .         .           g.147418
cccatcccagaacatttttttttattaccccaaaaggaaacccctacccaattaagcagt  c.7062-1201

.         .         .         .         .         .           g.147478
cactcaccattccttctaaccctggcaaccactaatctgttctctgtctctgtggatttg  c.7062-1141

.         .         .         .         .         .           g.147538
cctcttccagacatttggtaaaaacgaaatcatgcaatttgtgtgtctgacttctttcac  c.7062-1081

.         .         .         .         .         .           g.147598
ttagcttaatgttttcagagtccatccatgttatagcatgtatcattactttatagctga  c.7062-1021

.         .         .         .         .         .           g.147658
ataatattttgttttatggatatatatacaccacattttatttactggcacataatcttt  c.7062-961

.         .         .         .         .         .           g.147718
ttaacacaaaagaaacaaggcatgtttgtgcccctacaatcatgttttaagttagttagt  c.7062-901

.         .         .         .         .         .           g.147778
tcagggaaagacaggactagttggctttgtattattactctgttgtagtttgggagaaac  c.7062-841

.         .         .         .         .         .           g.147838
tgaaatgaaatcctgtgttattggcaaatcagccaaattgtactattgcctgtcaaaatg  c.7062-781

.         .         .         .         .         .           g.147898
ctttgcctgccatgtattctcattattagaattcaaatactgtacctccaaattatgtca  c.7062-721

.         .         .         .         .         .           g.147958
ctgaatcctaacttgccttcagagatgcagttttataaaaggtattgatgtgtagcaaat  c.7062-661

.         .         .         .         .         .           g.148018
taccctcaactacagcagtcataaacttagttataacttttttaaagtttgcattactct  c.7062-601

.         .         .         .         .         .           g.148078
cgagtgtcctgaattcacttcaggtaatgtgtttaaattacatatatggcagaattattt  c.7062-541

.         .         .         .         .         .           g.148138
tggactggtaataagttagtaagagcacagactctggagtcacactgctccgcagctata  c.7062-481

.         .         .         .         .         .           g.148198
tgacctcggcaagctgtgtaactctgtgccaattttctcacctgttaaaagttttaataa  c.7062-421

.         .         .         .         .         .           g.148258
taaggccaggcgcagtggctcatgcctgtaatcccagcactttgggaggccgaggcaggc  c.7062-361

.         .         .         .         .         .           g.148318
ggatcacgaggtcaggagattgagaccatcctggctaacacggtgaaaccccgtctctac  c.7062-301

.         .         .         .         .         .           g.148378
taaaaatacaaaaaattagctgggcgtggtggcacgtgcctgtagttgggctgaggcagg  c.7062-241

.         .         .         .         .         .           g.148438
agagaggcgtgaacctgggaggcaggacttgaagtaagccgagatggcgccactgcactc  c.7062-181

.         .         .         .         .         .           g.148498
cagcccaggccgtctcaaaaaaaataaataaataaaaaataaaggtttaataatagtacc  c.7062-121

.         .         .         .         .         .           g.148558
tattgtctaatgttagattaaatgactaaaagacattattgagtggcacatagtaggcac  c.7062-61

.         .         .         .         .         .           g.148618
tcagtatatattagctattagattttagatgtttttattttatatctggttctctttcag  c.7062-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center