ubiquitin specific peptidase 9, X-linked (USP9X) - 1790 nt intron 44 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.150022
gtaaacaggagtcagtttatgcttttatcccctagaactgggttttatgcttaattttag  c.7575+60

         .         .         .         .         .         .  g.150082
aggatggctcaattgtttgttgtgactacaaagtaagaagtaggattatctagactagct  c.7575+120

         .         .         .         .         .         .  g.150142
ttgggagcatgatccagaagagggatggtttggagtgggggtcatggtgtaacatgtttg  c.7575+180

         .         .         .         .         .         .  g.150202
aacttaaccactgtagggttttccttgtcaagaaggtgtccttcttgtgctagtagttaa  c.7575+240

         .         .         .         .         .         .  g.150262
taaaactgtatgagaatttatatcaacataaaatgatcattgtttagtgcaaaggattgt  c.7575+300

         .         .         .         .         .         .  g.150322
ggtgacatttccggtgaggtaaaatcttcacctggattccaaaaacattattaagatatg  c.7575+360

         .         .         .         .         .         .  g.150382
gcaatgaagtaagaagtccttggttacttagccacaggtttcagtgatggtaaaaatcac  c.7575+420

         .         .         .         .         .         .  g.150442
tggaaaaaaaaggatttgggtagatttccataggtgattaaagtaaataaactagtaaat  c.7575+480

         .         .         .         .         .         .  g.150502
agcaaaagaaatgagatgaagaaacattctaaatgataactttttctttctgaaaccaaa  c.7575+540

         .         .         .         .         .         .  g.150562
atgtgactaaatcagctcttgtgaggcagtggtactcaaacttgcacaggcgtgagtctc  c.7575+600

         .         .         .         .         .         .  g.150622
cctggaagggttgctccagcagagagctagatgctaccctaaagtgtcttatttcatagg  c.7575+660

         .         .         .         .         .         .  g.150682
tcttcaaggggctggaaaatgtacatttctagcaagttcccaagtgatgctgctggtggt  c.7575+720

         .         .         .         .         .         .  g.150742
ccaggaaccatacttggagaaacatttcaggcattctttcttacatttcactgtgtacat  c.7575+780

         .         .         .         .         .         .  g.150802
agaagcaaactgaatagttaggaagtacacattcagcgtacttattttcatctatagaaa  c.7575+840

         .         .         .         .         .       g.150857
gtaaagcctggccaggcgcggtagctcatgcctgtaatcccaacactttggaagg  c.7575+895

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.150912
     ctgaggcaggtggatcacctgaggtcaggagtttgagaccagcctgaccaacatg  c.7576-841

.         .         .         .         .         .           g.150972
gagaagccctgtctctactaaaaatacaaaattagccgggtatggtggtggcgcatgcct  c.7576-781

.         .         .         .         .         .           g.151032
gtaatcccagctactcaggaggctgaggcaagagaatctcttgaacccaggaggcagagg  c.7576-721

.         .         .         .         .         .           g.151092
tggtggtgagtcgagatagcaccattgcactccagcctgggcaacaagagcgaaactccc  c.7576-661

.         .         .         .         .         .           g.151152
atctcaaaaaaaaaaaaaaaaaagttaagcctaaaatcttggcttggctgatggagcatg  c.7576-601

.         .         .         .         .         .           g.151212
tacagaaaaatgagagcactgtagggttcagacattttaaaaggttaaggaaccaaatcc  c.7576-541

.         .         .         .         .         .           g.151272
acaaggaaggttaacttcctttgaccctgagaaagctcttatgttaatcatgcctggtta  c.7576-481

.         .         .         .         .         .           g.151332
ctttatcatcttgaacattgttctgtttttaatcagcattattgtgagttcagggttact  c.7576-421

.         .         .         .         .         .           g.151392
gctcctatatatcttacatcatggttagtcaatcggatttagcatgtggaagagtcaata  c.7576-361

.         .         .         .         .         .           g.151452
gatgctcatagatcattctctgaaaattttttaccaagagcaacagtgggttaatccttt  c.7576-301

.         .         .         .         .         .           g.151512
atttgccagacttgagtctaaataatttttggcactaaaaatcactttggccaaagattt  c.7576-241

.         .         .         .         .         .           g.151572
atgtggacctacacaatcactgctcttattcagggttttggggtttgcatttacactacg  c.7576-181

.         .         .         .         .         .           g.151632
tttttcaagcctttttttgtttttgtttttgtttttgttttgcactatagtagtccaagg  c.7576-121

.         .         .         .         .         .           g.151692
gtatttacagagtaagtcccaagaataagagtatacatttccagagacttcagaccatga  c.7576-61

.         .         .         .         .         .           g.151752
ttttgaagttgttttactatgtgaaaagttttaacatacagatcttttctcctttcccag  c.7576-1


Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center