vesicle-associated membrane protein 1 (synaptobrevin 1) (VAMP1) - coding DNA reference sequence

(used for variant description)

(last modified March 22, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_014231.3 in the VAMP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering VAMP1 transcript NM_014231.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5026
                                   agtaagttccagcgcagctagaccgc       c.-121

 .         .         .         .         .         .                g.5086
 ggggtagtcggcgcgaggcggagcttggcagttccgtccacttcagccgcagcgtccctc       c.-61

 .         .         .         .         .         .                g.5146
 accgggtgtctcgccgcagcctccggagaggaacagaccctcactctctctgtcagaaaa       c.-1

    | 02     .         .         .         .         .         .    g.9384
 AT | GTCTGCTCCAGCTCAGCCACCTGCTGAAGGGACAGAAGGGACTGCCCCAGGTGGGGGT    c.60
 M  |  S  A  P  A  Q  P  P  A  E  G  T  E  G  T  A  P  G  G  G      p.20

          .         .         .         .         .         .       g.9444
 CCCCCTGGCCCTCCTCCTAACATGACCAGTAACAGACGACTACAGCAAACCCAGGCACAA       c.120
 P  P  G  P  P  P  N  M  T  S  N  R  R  L  Q  Q  T  Q  A  Q         p.40

           | 03        .         .         .         .         .    g.9728
 GTGGAGGAG | GTGGTGGACATCATACGTGTGAACGTGGACAAGGTCCTGGAGAGGGACCAG    c.180
 V  E  E   | V  V  D  I  I  R  V  N  V  D  K  V  L  E  R  D  Q      p.60

          .         .         .         .         .         .       g.9788
 AAGCTGTCAGAGCTGGATGACCGAGCTGATGCCTTGCAGGCAGGAGCATCACAATTTGAG       c.240
 K  L  S  E  L  D  D  R  A  D  A  L  Q  A  G  A  S  Q  F  E         p.80

          .         .         .         .         | 04         .    g.10748
 AGCAGTGCTGCCAAGCTAAAGAGGAAGTATTGGTGGAAAAACTGCAAG | ATGATGATCATG    c.300
 S  S  A  A  K  L  K  R  K  Y  W  W  K  N  C  K   | M  M  I  M      p.100

          .         .         .         . | 05       .              g.11211
 CTGGGAGCCATCTGTGCCATCATCGTGGTAGTTATTGTAA | TCTACTTTTTTACTTGA       c.357
 L  G  A  I  C  A  I  I  V  V  V  I  V  I |   Y  F  F  T  X         p.118

          .         .         .         .         .         .       g.11271
 gaatgtaccaccccttccctgttgtccattgccatccacattcatgtcctctgccctctg       c.*60

          .         .         .         .         .         .       g.11331
 tttgctctctcaacacacttccccacccaccgtcctccattccagcccaggcttctccat       c.*120

          .         .         .         .         .         .       g.11391
 cacccattcctcctttttcgttgcgttcatttgcactctgtccctcaacactagaaatgc       c.*180

          .         .         .         .         .         .       g.11451
 tgctcgtggcacaatctaagtcattacccgaagagcaacagctggcgcctcctccctgcc       c.*240

          .         .         .         .         .         .       g.11511
 tgctttttctgtactctcaagttcccccaaagccccaaagagttggaggccaagggaagg       c.*300

          .         .         .         .         .         .       g.11571
 ggcagggaggggagtggctgaggcgaagtacccatgaagctgcccagacttgggaggaga       c.*360

          .         .         .         .         .         .       g.11631
 agagtatcggtgcccatggtgacttctagaaaacctggccactggtaggagctagggagg       c.*420

          .         .         .         .         .         .       g.11691
 ggctgggaagatggcagctcactcagtactgcctggtcatgtggagctttccttcctgga       c.*480

          .         .         .         .         .         .       g.11751
 ccaggcctgaagagggtcctgggggtggaccaaagtccaacttggtttcagtgcagtacc       c.*540

          .         .         .         .         .         .       g.11811
 cttttcgaaagtaaaaacttgttttttgtagttatttctaatctgttcgtccaggatttt       c.*600

          .         .         .         .         .         .       g.11871
 ccgtgtctttggggatcttacaactttactttgttctccagaggcctggagaacacttag       c.*660

          .         .         .         .         .         .       g.11931
 ggattgtgaaaatagcaggacttgtttccatcctagaagcagtcccatgtgcttctagct       c.*720

          .         .         .         .         .         .       g.11991
 ggaaggagctttctcttctttacattttctacagcattctgtatgagggcaccaaataaa       c.*780

          .         .         .         .         .         .       g.12051
 tccatctagctggtagttttatctagccaaataatttaacctagctcccagttaattgtt       c.*840

          .         .         .         .         .         .       g.12111
 ggcataaagagagagattgcctgttagttatagagaaacagtgagtcaagtgcttaattt       c.*900

          .         .         .         .         .         .       g.12171
 gaaagtaacaagctcagaggaagccactccttgccctcgttaaagagggtcctgttcctc       c.*960

          .         .         .         .         .         .       g.12231
 tcttcctgttgatgaaggagcgtgagggtgttagcagtgtgagatctttggacacccatg       c.*1020

          .         .         .         .         .         .       g.12291
 gaatcctttcctccacaccacccgtgcacttgccaaagacagggatgaggcaagtggttc       c.*1080

          .         .         .         .         .         .       g.12351
 ttcctggggcccggccgatcctcaggatgcagagaagtcatgtagacccaccagccccac       c.*1140

          .         .         .         .         .         .       g.12411
 cttggggggaggcgtgccagcctgtgtcaggtgtgcttgtgtattgctgtgctgtcatgg       c.*1200

          .         .         .         .         .         .       g.12471
 ggccctctccttgagagccgcctctctgttcttcctgtagtatattcccctttgaaccac       c.*1260

          .         .         .         .         .         .       g.12531
 cctttcctgtctgaattctactttgcctcctttctcttcctcctctttgcatggtttgtg       c.*1320

          .         .         .         .         .         .       g.12591
 tgtatagacagtggaacctgaggatgggatctgctcagcctatcttcggggcaattgctg       c.*1380

          .         .         .         .         .         .       g.12651
 agcttcaggatgggctattaatgtgggataagcccaggtgcaaggggaggagggcaggct       c.*1440

          .         .         .         .         .         .       g.12711
 gggaacagagcggagaatgcccatggccctttattccttcttccctcggtccacgaacag       c.*1500

          .         .         .         .         .         .       g.12771
 gaagaggctgaggccatgctgggcagggtctggatgcccactttccatgcagcagcattt       c.*1560

          .         .         .         .         .         .       g.12831
 cattgctcaaaaccatccttcctttcctttcgcccttgtttcccacattcccttcgtcct       c.*1620

          .         .         .         .         .         .       g.12891
 gcccaagggcgggactgaagagctggaagaaagcagtcagtaccctcccaacggcccccc       c.*1680

          .         .         .         .         .         .       g.12951
 tcgaaggtctccactctcctctgggctcctccttgcctaatgcagggggtcaccgctgga       c.*1740

          .         .         .         .         .         .       g.13011
 gaagaaccaccactgtcctcgatgtgtcccaagcctggagcgaatccgtcctcttggctc       c.*1800

          .         .         .         .         .         .       g.13071
 tcccagccctatcacaggaatcattcctgggtttctgtccctctgaggctcaccaggtgt       c.*1860

          .         .         .         .         .         .       g.13131
 agttggccttgttctttgggggtattagcccttctactttctttctcacccaccctgtac       c.*1920

          .         .         .         .         .         .       g.13191
 cctcttctgtgtgtctctgctatccccctttcctcccaccacccatgtgcatgagcaaat       c.*1980

          .         .         .         .         .         .       g.13251
 gtgcaacaaaaccctgggactttgcagtcaaatgaagctgagcttcccacatcccgttct       c.*2040

          .         .         .         .         .         .       g.13311
 tcggtttgccatgagacgatgtggggtttccactgtgtgtctgtcatcacctctttgtct       c.*2100

          .         .         .         .         .         .       g.13371
 ttttttcctaaccctgatctcatacttgtatagagtaataacaacagttgtacttccacc       c.*2160

          .         .         .         .         .         .       g.13431
 aaaggcatgtggcatatttaccaatgtcatgtattctgaacaaaggcaaaaaatacaaat       c.*2220

          .                                                         g.13444
 tcctaccattaaa                                                      c.*2233

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Vesicle-associated membrane protein 1 (synaptobrevin 1) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.