vesicle-associated membrane protein 2 (synaptobrevin 2) (VAMP2) - coding DNA reference sequence

(used for variant description)

(last modified October 11, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_014232.2 in the VAMP2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering VAMP2 transcript NM_014232.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5036
                         atctttccgtcccgggcagccagcgccagtcggagc       c.-61

 .         .         .         .         .         .                g.5096
 cagcgcgagccgccgccgccatcactgccgctgccaagtcctccacccgctgcccccgcc       c.-1

    | 02     .         .         .         .         .         .    g.5664
 AT | GTCTGCTACCGCTGCCACGGCCCCCCCTGCTGCCCCGGCTGGGGAGGGTGGTCCCCCT    c.60
 M  |  S  A  T  A  A  T  A  P  P  A  A  P  A  G  E  G  G  P  P      p.20

          .         .         .         .         .         .       g.5724
 GCACCCCCTCCAAACCTCACCAGTAACAGGAGACTGCAGCAGACCCAGGCCCAGGTGGAT       c.120
 A  P  P  P  N  L  T  S  N  R  R  L  Q  Q  T  Q  A  Q  V  D         p.40

     | 03    .         .         .         .         .         .    g.6266
 GAG | GTGGTGGACATCATGAGGGTGAACGTGGACAAGGTCCTGGAGCGAGACCAGAAGCTG    c.180
 E   | V  V  D  I  M  R  V  N  V  D  K  V  L  E  R  D  Q  K  L      p.60

          .         .         .         .         .         .       g.6326
 TCGGAGCTGGACGACCGTGCAGATGCACTCCAGGCGGGGGCCTCCCAGTTTGAAACAAGC       c.240
 S  E  L  D  D  R  A  D  A  L  Q  A  G  A  S  Q  F  E  T  S         p.80

          .         .         .         .   | 04     .         .    g.6469
 GCAGCCAAGCTCAAGCGCAAATACTGGTGGAAAAACCTCAAG | ATGATGATCATCTTGGGA    c.300
 A  A  K  L  K  R  K  Y  W  W  K  N  L  K   | M  M  I  I  L  G      p.100

          .         .         .     | 05   .         .              g.7130
 GTGATTTGCGCCATCATCCTCATCATCATCATAG | TTTACTTCAGCACTTAA             c.351
 V  I  C  A  I  I  L  I  I  I  I  V |   Y  F  S  T  X               p.116

          .         .         .         .         .         .       g.7190
 atccccgaggagtctgccctgcctagagaagggcctctcccccaaccctcagccgttcct       c.*60

          .         .         .         .         .         .       g.7250
 ccacctctcagccatatctttcagcccccactcccctggatccgtgtgtgtgtgtgtccg       c.*120

          .         .         .         .         .         .       g.7310
 tgtgtgtgtccccctgtaaatagccagctgttatttatacatatataatattatatatat       c.*180

          .         .         .         .         .         .       g.7370
 ttggtctgtttgtagttttattactagatgatttttccggttgtccttaacaccccttcc       c.*240

          .         .         .         .         .         .       g.7430
 tgaggttcccttcacccctctctcttgccttccttccctttccctttcttcctgactagc       c.*300

          .         .         .         .         .         .       g.7490
 cccaagtcccttcatttgcatctgctatgcaatagtccctctcctttccttcttcttccc       c.*360

          .         .         .         .         .         .       g.7550
 tcagatttagctgatccttcctcccaccctggccttcctttcctctttcctcctcactct       c.*420

          .         .         .         .         .         .       g.7610
 ccccgtcatgctccctctgccccgccctcaaaaaaaaaaaaaaaaaaaaaaaaacaacag       c.*480

          .         .         .         .         .         .       g.7670
 cacctgtccaggcttccttaggtacatcttctttgtatccattgggaggctctgagactg       c.*540

          .         .         .         .         .         .       g.7730
 gccccacttggtcctaagaatcccaaggtctttgggagcgtccagcatgttaattagcgt       c.*600

          .         .         .         .         .         .       g.7790
 atcattacatactgctatccctttccatttctttttgttccatcactcttctctcaacct       c.*660

          .         .         .         .         .         .       g.7850
 gtgtttctttttttactgaggagttagtccccattagttcttgtatcacattttcatttg       c.*720

          .         .         .         .         .         .       g.7910
 cacgacattactcgcaggtggtggggagcctgggcttttggggaaccaggctgctctggt       c.*780

          .         .         .         .         .         .       g.7970
 ccccagcattgcctcctcctagcccctctagtccagtttgcctcccttaccctcattttc       c.*840

          .         .         .         .         .         .       g.8030
 caaacctcttgtaccctcctctccctcccccagctggtatgtaagtgtcttgaagttcag       c.*900

          .         .         .         .         .         .       g.8090
 tatgttatgatggaccaataattctgccacttcgggtttctccctacattcctgctcccc       c.*960

          .         .         .         .         .         .       g.8150
 agttttcatgtggggtactcaactgacattcccatggggtttccctcccatctgcctgat       c.*1020

          .         .         .         .         .         .       g.8210
 ccacctcctcctcccaccaggagagttgggggttggccacaattgatctcttgtgagagg       c.*1080

          .         .         .         .         .         .       g.8270
 ggtggctaccagtgtgtgtgtgggggtcatcactgccttggggaggagtggggcagggca       c.*1140

          .         .         .         .         .         .       g.8330
 gagaatccccccaattcctgcctgaaatctctggcctcacccctgctgggggttggactg       c.*1200

          .         .         .         .         .         .       g.8390
 aaaaccctcctccccaatttggggggtgttgccccatcactgcccagctcctctgactgc       c.*1260

          .         .         .         .         .         .       g.8450
 cccccctgaatttagggtgggggtactagtcactgccaatgtgtgtatgggacttgctgg       c.*1320

          .         .         .         .         .         .       g.8510
 aaaacggggatgcttgcccctctccaggactattgagcccagagagagctgtcctctcat       c.*1380

          .         .         .         .         .         .       g.8570
 tgggtgaactgattgaggaagggtctattgtctttttaaatggcacaattttaagggttt       c.*1440

          .         .         .         .         .         .       g.8630
 gagggtacagtcccttaacctgccacgggagggggcccccaaactttcttccccccacac       c.*1500

          .         .         .         .         .         .       g.8690
 ttctggttttctgtgtggagggggagcagggatatctaagctgtggtgtgaaagggtagg       c.*1560

          .         .         .         .         .         .       g.8750
 agagatgctggaggtgggggtgctgtgttttagaccccccatattatcccagtgtcccct       c.*1620

          .         .         .         .         .         .       g.8810
 gcccccctcttcccccaccccatgcccccaattctgtggcgcatccagattgtgaaaatg       c.*1680

          .         .                                               g.8838
 tacaataaatgtgtaatgagtaaccagg                                       c.*1708

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Vesicle-associated membrane protein 2 (synaptobrevin 2) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.