valosin containing protein (VCP) - coding DNA reference sequence

(used for variant description)

(last modified January 19, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_007126.3 in the VCP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007887.1, covering VCP transcript NM_007126.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5029
                                gtgatctgcgggttgctggggagaggcgc       c.-361

 .         .         .         .         .         .                g.5089
 ggagaggcgggcgagagtccgcagggcaggcgctgattggctgaggtgggagcagcttcc       c.-301

 .         .         .         .         .         .                g.5149
 cttccgatgattcggctcttctcggctcagtctcagcgaagcgtctgcgaccgtcgtttg       c.-241

 .         .         .         .         .         .                g.5209
 agtcgtcgctgccgctgccgctgccactgccactgccacctcgcggatcaggagccagcg       c.-181

 .         .         .         .         .         .                g.5269
 ttgttcgcccgacgcctcgctgccggtgggaggaagcgagagggaagccgcttgcgggtt       c.-121

 .         .         .         .         .         .                g.5329
 tgtcgccgctgctcgcccaccgcctggaagagccgagccccggcccagtcggtcgcttgc       c.-61

 .         .         .         .         .         .                g.5389
 caccgctcgtagccgttacccgcgggccgccacagccgccggccgggagaggcgcgcgcc       c.-1

          .        | 02.         .         .         .         .    g.9423
 ATGGCTTCTGGAGCCGA | TTCAAAAGGTGATGACCTATCAACAGCCATTCTCAAACAGAAG    c.60
 M  A  S  G  A  D  |  S  K  G  D  D  L  S  T  A  I  L  K  Q  K      p.20

          .         .         .         .         .         .       g.9483
 AACCGTCCCAATCGGTTAATTGTTGATGAAGCCATCAATGAGGACAACAGTGTGGTGTCC       c.120
 N  R  P  N  R  L  I  V  D  E  A  I  N  E  D  N  S  V  V  S         p.40

           | 03        .         .         .         .         .    g.9730
 TTGTCCCAG | CCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGCTGAAA    c.180
 L  S  Q   | P  K  M  D  E  L  Q  L  F  R  G  D  T  V  L  L  K      p.60

          .         .         .         .         .         .       g.9790
 GGAAAGAAGAGACGAGAAGCTGTTTGCATCGTCCTTTCTGATGATACTTGTTCTGATGAG       c.240
 G  K  K  R  R  E  A  V  C  I  V  L  S  D  D  T  C  S  D  E         p.80

          .         .         .         .         .         .       g.9850
 AAGATTCGGATGAATAGAGTTGTTCGGAATAACCTTCGTGTACGCCTAGGGGATGTCATC       c.300
 K  I  R  M  N  R  V  V  R  N  N  L  R  V  R  L  G  D  V  I         p.100

    | 04     .         .         .         .         .         .    g.10983
 AG | CATCCAGCCATGCCCTGATGTGAAGTACGGCAAACGTATCCATGTGCTGCCCATTGAT    c.360
 S  |  I  Q  P  C  P  D  V  K  Y  G  K  R  I  H  V  L  P  I  D      p.120

          .         .         .         .         .         .       g.11043
 GACACAGTGGAAGGCATTACTGGTAATCTCTTCGAGGTATACCTTAAGCCGTACTTCCTG       c.420
 D  T  V  E  G  I  T  G  N  L  F  E  V  Y  L  K  P  Y  F  L         p.140

          .         .      | 05  .         .         .         .    g.12396
 GAAGCGTATCGACCCATCCGGAAAG | GAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCT    c.480
 E  A  Y  R  P  I  R  K  G |   D  I  F  L  V  R  G  G  M  R  A      p.160

          .         .         .         .         .         .       g.12456
 GTGGAGTTCAAAGTGGTGGAAACAGATCCTAGCCCTTATTGCATTGTTGCTCCAGACACA       c.540
 V  E  F  K  V  V  E  T  D  P  S  P  Y  C  I  V  A  P  D  T         p.180

          .         .         .       | 06 .         .         .    g.13481
 GTGATCCACTGCGAAGGGGAGCCTATCAAACGAGAG | GATGAGGAAGAGTCCTTGAATGAA    c.600
 V  I  H  C  E  G  E  P  I  K  R  E   | D  E  E  E  S  L  N  E      p.200

          .         .         .         .         .         .       g.13541
 GTAGGGTATGATGACATTGGTGGCTGCAGGAAGCAGCTAGCTCAGATAAAGGAGATGGTG       c.660
 V  G  Y  D  D  I  G  G  C  R  K  Q  L  A  Q  I  K  E  M  V         p.220

          .         .         .         .         | 07         .    g.14674
 GAACTGCCCCTGAGACATCCTGCCCTCTTTAAGGCAATTGGTGTGAAG | CCTCCTAGAGGA    c.720
 E  L  P  L  R  H  P  A  L  F  K  A  I  G  V  K   | P  P  R  G      p.240

          .         .         .         .         .         .       g.14734
 ATCCTGCTTTACGGACCTCCTGGAACAGGAAAGACCCTGATTGCTCGAGCTGTAGCAAAT       c.780
 I  L  L  Y  G  P  P  G  T  G  K  T  L  I  A  R  A  V  A  N         p.260

          .         .         .  | 08      .         .         .    g.15421
 GAGACTGGAGCCTTCTTCTTCTTGATCAATG | GTCCTGAGATCATGAGCAAATTGGCTGGT    c.840
 E  T  G  A  F  F  F  L  I  N  G |   P  E  I  M  S  K  L  A  G      p.280

          .         .         .         .         .         .       g.15481
 GAGTCTGAGAGCAACCTTCGTAAAGCCTTTGAGGAGGCTGAGAAGAATGCTCCTGCCATC       c.900
 E  S  E  S  N  L  R  K  A  F  E  E  A  E  K  N  A  P  A  I         p.300

          .         .         .         .      | 09  .         .    g.15619
 ATCTTCATTGATGAGCTAGATGCCATCGCTCCCAAAAGAGAGAAA | ACTCATGGCGAGGTG    c.960
 I  F  I  D  E  L  D  A  I  A  P  K  R  E  K   | T  H  G  E  V      p.320

          .         .         .         .         .         .       g.15679
 GAGCGGCGCATTGTATCACAGTTGTTGACCCTCATGGATGGCCTAAAGCAGAGGGCACAT       c.1020
 E  R  R  I  V  S  Q  L  L  T  L  M  D  G  L  K  Q  R  A  H         p.340

          .         .         .         .         .         .       g.15739
 GTGATTGTTATGGCAGCAACCAACAGACCCAACAGCATTGACCCAGCTCTACGGCGATTT       c.1080
 V  I  V  M  A  A  T  N  R  P  N  S  I  D  P  A  L  R  R  F         p.360

   | 10      .         .         .         .         .         .    g.16112
 G | GTCGCTTTGACAGGGAGGTAGATATTGGAATTCCTGATGCTACAGGACGCTTAGAGATT    c.1140
 G |   R  F  D  R  E  V  D  I  G  I  P  D  A  T  G  R  L  E  I      p.380

          .         .         .         .         .     | 11   .    g.16569
 CTTCAGATCCATACCAAGAACATGAAGCTGGCAGATGATGTGGACCTGGAACAG | GTAGCC    c.1200
 L  Q  I  H  T  K  N  M  K  L  A  D  D  V  D  L  E  Q   | V  A      p.400

          .         .         .         .         .         .       g.16629
 AATGAGACTCACGGGCATGTGGGTGCTGACTTAGCAGCCCTGTGCTCAGAGGCTGCTCTG       c.1260
 N  E  T  H  G  H  V  G  A  D  L  A  A  L  C  S  E  A  A  L         p.420

          .         .         .         .         .         .       g.16689
 CAAGCCATCCGCAAGAAGATGGATCTCATTGACCTAGAGGATGAGACCATTGATGCCGAG       c.1320
 Q  A  I  R  K  K  M  D  L  I  D  L  E  D  E  T  I  D  A  E         p.440

          .         .         .          | 12        .         .    g.16840
 GTCATGAACTCTCTAGCAGTTACTATGGATGACTTCCGG | TGGGCCTTGAGCCAGAGTAAC    c.1380
 V  M  N  S  L  A  V  T  M  D  D  F  R   | W  A  L  S  Q  S  N      p.460

          .         .         .         .         .         .       g.16900
 CCATCAGCACTGCGGGAAACCGTGGTAGAGGTGCCACAGGTAACCTGGGAAGACATCGGG       c.1440
 P  S  A  L  R  E  T  V  V  E  V  P  Q  V  T  W  E  D  I  G         p.480

          .         .         .         .   | 13     .         .    g.17235
 GGCCTAGAGGATGTCAAACGTGAGCTACAGGAGCTGGTCCAG | TATCCTGTGGAGCACCCA    c.1500
 G  L  E  D  V  K  R  E  L  Q  E  L  V  Q   | Y  P  V  E  H  P      p.500

          .         .         .         .         .         .       g.17295
 GACAAATTCCTGAAGTTTGGCATGACACCTTCCAAGGGAGTTCTGTTCTATGGACCTCCT       c.1560
 D  K  F  L  K  F  G  M  T  P  S  K  G  V  L  F  Y  G  P  P         p.520

          .         .         .         .         .         .       g.17355
 GGCTGTGGGAAAACTTTGTTGGCCAAAGCCATTGCTAATGAATGCCAGGCCAACTTCATC       c.1620
 G  C  G  K  T  L  L  A  K  A  I  A  N  E  C  Q  A  N  F  I         p.540

          .         .         .         .         .         .       g.17415
 TCCATCAAGGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAGTCTGAGGCCAATGTCAGA       c.1680
 S  I  K  G  P  E  L  L  T  M  W  F  G  E  S  E  A  N  V  R         p.560

          .      | 14  .         .         .         .         .    g.17986
 GAAATCTTTGACAAG | GCCCGCCAAGCTGCCCCCTGTGTGCTATTCTTTGATGAGCTGGAT    c.1740
 E  I  F  D  K   | A  R  Q  A  A  P  C  V  L  F  F  D  E  L  D      p.580

          .         .         .         .         .         .       g.18046
 TCGATTGCCAAGGCTCGTGGAGGTAACATTGGAGATGGTGGTGGGGCTGCTGACCGAGTC       c.1800
 S  I  A  K  A  R  G  G  N  I  G  D  G  G  G  A  A  D  R  V         p.600

          .         .         .         .         .         .       g.18106
 ATCAACCAGATCCTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTCATCATT       c.1860
 I  N  Q  I  L  T  E  M  D  G  M  S  T  K  K  N  V  F  I  I         p.620

          .         .         .         .         .         .       g.18166
 GGCGCTACCAACCGGCCTGACATCATTGATCCTGCCATCCTCAGACCTGGCCGTCTTGAT       c.1920
 G  A  T  N  R  P  D  I  I  D  P  A  I  L  R  P  G  R  L  D         p.640

          .         .         .         .         .         .       g.18226
 CAGCTCATCTACATCCCACTTCCTGATGAGAAGTCCCGTGTTGCCATCCTCAAGGCTAAC       c.1980
 Q  L  I  Y  I  P  L  P  D  E  K  S  R  V  A  I  L  K  A  N         p.660

          .         .     | 15   .         .         .         .    g.18559
 CTGCGCAAGTCCCCAGTTGCCAAG | GATGTGGACTTGGAGTTCCTGGCTAAAATGACTAAT    c.2040
 L  R  K  S  P  V  A  K   | D  V  D  L  E  F  L  A  K  M  T  N      p.680

          .         .         .         .         .         .       g.18619
 GGCTTCTCTGGAGCTGACCTGACAGAGATTTGCCAGCGTGCTTGCAAGCTGGCCATCCGT       c.2100
 G  F  S  G  A  D  L  T  E  I  C  Q  R  A  C  K  L  A  I  R         p.700

          .         .         .         .         .         .       g.18679
 GAATCCATCGAGAGTGAGATTAGGCGAGAACGAGAGAGGCAGACAAACCCATCAGCCATG       c.2160
 E  S  I  E  S  E  I  R  R  E  R  E  R  Q  T  N  P  S  A  M         p.720

  | 16       .         .         .         .         .         .    g.20272
  | GAGGTAGAAGAGGATGATCCAGTGCCTGAGATCCGTCGAGATCACTTTGAAGAAGCCATG    c.2220
  | E  V  E  E  D  D  P  V  P  E  I  R  R  D  H  F  E  E  A  M      p.740

          .         .         .         .         .         .       g.20332
 CGCTTTGCGCGCCGTTCTGTCAGTGACAATGACATTCGGAAGTATGAGATGTTTGCCCAG       c.2280
 R  F  A  R  R  S  V  S  D  N  D  I  R  K  Y  E  M  F  A  Q         p.760

          .         .         .      | 17  .         .         .    g.20545
 ACCCTTCAGCAGAGTCGGGGCTTTGGCAGCTTCAG | ATTCCCTTCAGGGAACCAGGGTGGA    c.2340
 T  L  Q  Q  S  R  G  F  G  S  F  R  |  F  P  S  G  N  Q  G  G      p.780

          .         .         .         .         .         .       g.20605
 GCTGGCCCCAGTCAGGGCAGTGGAGGCGGCACAGGTGGCAGTGTATACACAGAAGACAAT       c.2400
 A  G  P  S  Q  G  S  G  G  G  T  G  G  S  V  Y  T  E  D  N         p.800

          .         .                                               g.20626
 GATGATGACCTGTATGGCTAA                                              c.2421
 D  D  D  L  Y  G  X                                                p.806

          .         .         .         .         .         .       g.20686
 gtggtggtggccagcgtgcagtgagctggcctgcctggaccttgttccctgggggtgggg       c.*60

          .         .         .         .         .         .       g.20746
 gcgcttgcccaggagagggaccaggggtgcgcccacagcctgctccattctccagtctga       c.*120

          .         .         .         .         .         .       g.20806
 acagttcagctacagtctgactctggacagggggtttctgttgcaaaaatacaaaacaaa       c.*180

          .         .         .         .         .         .       g.20866
 agcgataaaataaaagcgattttcatttggtaggcggagagtgaattaccaacagggaat       c.*240

          .         .         .         .         .         .       g.20926
 tgggccttgggcctatgccatttctgttgtagtttggggcagtgcaggggacctgtgtgg       c.*300

          .         .         .         .         .         .       g.20986
 ggtgtgaaccaaggcactactgccacctgccacagtaaagcatctgcacttgactcaatg       c.*360

          .         .         .         .         .         .       g.21046
 ctgcccgagccctcccttccccctatccaacctgggtaggtgggtaggggccacagttgc       c.*420

          .         .         .         .         .         .       g.21106
 tggatgtttatatagagagtaggttgatttattttacatgcttttgagttaatgttggaa       c.*480

          .         .         .         .         .         .       g.21166
 aactaatcacaagcagtttctaaaccaaaaaatgacatgttgtaaaaggacaataaacgt       c.*540

          .         .         .         .         .         .       g.21226
 tgggtcaaaatggagcctgagtcctgggccctgtgcctgcttcttttcctgggaacagcc       c.*600

          .         .         .         .         .         .       g.21286
 ttgggctacccaccactcccaaggcattcttccaaatgtgaaatcctggaagtaagattg       c.*660

          .         .         .         .         .         .       g.21346
 caccttcttcctctcctgatcaacatcggtatgatgtctcctgttgcctcaccctttgtc       c.*720

          .         .         .         .         .         .       g.21406
 tgcagtatcactggataggactggtggaaagggagcagcctgacagagctccaaatgtgg       c.*780

          .         .         .         .         .         .       g.21466
 agaatatggcatccctccacctatatttgatgtggacggtaaggctaggcctgcaggatc       c.*840

          .         .         .         .         .         .       g.21526
 ccttatcctgaccaaagactgtgttggggtgccatttgaaaatcgcagggttgcaaaaga       c.*900

          .         .         .         .         .         .       g.21586
 atacaatcttacttgcaggtggatattctctatactctcttttaatgcatctaaaaatcc       c.*960

          .         .         .         .         .         .       g.21646
 caaacatcccctggttggtgatcacttacagttgtgtccacctttattttatgtactttg       c.*1020

          .         .                                               g.21675
 attaaaaaaaaaaaactttttgttaatat                                      c.*1049

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Valosin containing protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2019 Leiden University Medical Center