vitamin K epoxide reductase complex, subunit 1 (VKORC1) - coding DNA reference sequence

(used for variant description)

(last modified September 28, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_024006.4 in the VKORC1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011564.1, covering VKORC1 transcript NM_024006.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5046
               cgattccgcacgtcccttacccgcttcactagtcccggcattcttc       c.-181

 .         .         .         .         .         .                g.5106
 gctgttttcctaactcgcccgcttgactagcgccctggaacagccatttgggtcgtggag       c.-121

 .         .         .         .         .         .                g.5166
 tgcgagcacggccggccaatcgccgagtcagagggccaggaggggcgcggccattcgccg       c.-61

 .         .         .         .         .         .                g.5226
 cccggcccctgctccgtggctggttttctccgcgggcgcctcgggcggaacctggagata       c.-1

          .         .         .         .         .         .       g.5286
 ATGGGCAGCACCTGGGGGAGCCCTGGCTGGGTGCGGCTCGCTCTTTGCCTGACGGGCTTA       c.60
 M  G  S  T  W  G  S  P  G  W  V  R  L  A  L  C  L  T  G  L         p.20

          .         .         .         .         .         .       g.5346
 GTGCTCTCGCTCTACGCGCTGCACGTGAAGGCGGCGCGCGCCCGGGACCGGGATTACCGC       c.120
 V  L  S  L  Y  A  L  H  V  K  A  A  R  A  R  D  R  D  Y  R         p.40

          .         .         .         .         .    | 02    .    g.6541
 GCGCTCTGCGACGTGGGCACCGCCATCAGCTGTTCGCGCGTCTTCTCCTCCAG | GTGGGGC    c.180
 A  L  C  D  V  G  T  A  I  S  C  S  R  V  F  S  S  R  |  W  G      p.60

          .         .         .         .         .         .       g.6601
 AGGGGTTTCGGGCTGGTGGAGCATGTGCTGGGACAGGACAGCATCCTCAATCAATCCAAC       c.240
 R  G  F  G  L  V  E  H  V  L  G  Q  D  S  I  L  N  Q  S  N         p.80

          .         .         .         .    | 03    .         .    g.8630
 AGCATATTCGGTTGCATCTTCTACACACTACAGCTATTGTTAG | GTTGCCTGCGGACACGC    c.300
 S  I  F  G  C  I  F  Y  T  L  Q  L  L  L  G |   C  L  R  T  R      p.100

          .         .         .         .         .         .       g.8690
 TGGGCCTCTGTCCTGATGCTGCTGAGCTCCCTGGTGTCTCTCGCTGGTTCTGTCTACCTG       c.360
 W  A  S  V  L  M  L  L  S  S  L  V  S  L  A  G  S  V  Y  L         p.120

          .         .         .         .         .         .       g.8750
 GCCTGGATCCTGTTCTTCGTGCTCTATGATTTCTGCATTGTTTGTATCACCACCTATGCT       c.420
 A  W  I  L  F  F  V  L  Y  D  F  C  I  V  C  I  T  T  Y  A         p.140

          .         .         .         .         .         .       g.8810
 ATCAACGTGAGCCTGATGTGGCTCAGTTTCCGGAAGGTCCAAGAACCCCAGGGCAAGGCT       c.480
 I  N  V  S  L  M  W  L  S  F  R  K  V  Q  E  P  Q  G  K  A         p.160

          .                                                         g.8822
 AAGAGGCACTGA                                                       c.492
 K  R  H  X                                                         p.163

          .         .         .         .         .         .       g.8882
 gccctcaacccaagccaggctgacctcatctgctttgctttggcatgtgagccttgccta       c.*60

          .         .         .         .         .         .       g.8942
 agggggcatatctgggtccctagaaggccctagatgtggggcttctagattaccccctcc       c.*120

          .         .         .         .         .         .       g.9002
 tcctgccatacccgcacatgacaatggaccaaatgtgccacacgctcgctcttttttaca       c.*180

          .         .         .         .         .         .       g.9062
 cccagtgcctctgactctgtccccatgggctggtctccaaagctctttccattgcccagg       c.*240

          .         .         .         .                           g.9102
 gagggaaggttctgagcaataaagtttcttagatcaatca                           c.*280

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Vitamin K epoxide reductase complex, subunit 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.