vacuolar protein sorting 13 homolog A (S. cerevisiae) (VPS13A) - coding DNA reference sequence

(used for variant description)

(last modified July 22, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_033305.2 in the VPS13A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008931.1, covering VPS13A transcript NM_033305.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5020
                                         ttcctccctctcagggctgc       c.-241

 .         .         .         .         .         .                g.5080
 gcgcccaggtctgcgccgcgctccgcctccagccgcgcgcagacttgcgcacgcgtcgtg       c.-181

 .         .         .         .         .         .                g.5140
 agagcgaccgcctccgtctctcgctgggctcgctagggctgcgcgttgggccagcggggg       c.-121

 .         .         .         .         .         .                g.5200
 cgccgcagctgaagccgccccggagccggtgaaccgaattacctcgagggaggggcgtgg       c.-61

 .         .         .         .         .         .                g.5260
 ggaaggcggcgggaggaggagcgcacgggccggctgccgtgcccaccacggctgaggaac       c.-1

          .         .         .         .         .         .       g.5320
 ATGGTTTTCGAGTCGGTGGTCGTGGACGTGTTGAACCGGTTCTTGGGGGACTATGTGGTG       c.60
 M  V  F  E  S  V  V  V  D  V  L  N  R  F  L  G  D  Y  V  V         p.20

          .         .         .         . | 02       .         .    g.27520
 GACTTGGACACGTCCCAGCTCTCTCTGGGCATCTGGAAAG | GAGCTGTGGCCCTCAAGAAT    c.120
 D  L  D  T  S  Q  L  S  L  G  I  W  K  G |   A  V  A  L  K  N      p.40

          .         .     | 03   .         .         .         .    g.28956
 CTTCAAATTAAAGAAAATGCCCTG | AGTCAACTGGATGTACCATTTAAAGTTAAAGTTGGT    c.180
 L  Q  I  K  E  N  A  L   | S  Q  L  D  V  P  F  K  V  K  V  G      p.60

         | 04.         .         .         .         .         .    g.32921
 CACATAG | GTAATCTTAAACTTATAATTCCATGGAAAAACCTTTATACTCAACCTGTTGAA    c.240
 H  I  G |   N  L  K  L  I  I  P  W  K  N  L  Y  T  Q  P  V  E      p.80

          .         .         .         .    | 05    .         .    g.33550
 GCCGTATTGGAAGAAATTTATTTACTTATAGTGCCTTCTTCTA | GAATAAAATATGATCCT    c.300
 A  V  L  E  E  I  Y  L  L  I  V  P  S  S  R |   I  K  Y  D  P      p.100

          .         .         .         .         .         .       g.33610
 TTAAAAGAAGAGAAACAACTCATGGAAGCAAAGCAACAGGAACTGAAAAGAATAGAAGAA       c.360
 L  K  E  E  K  Q  L  M  E  A  K  Q  Q  E  L  K  R  I  E  E         p.120

          .         .      | 06  .         .         .         .    g.37013
 GCAAAACAAAAAGTAGTTGATCAAG | AACAACATCTGCCGGAAAAACAGGACACTTTTGCA    c.420
 A  K  Q  K  V  V  D  Q  E |   Q  H  L  P  E  K  Q  D  T  F  A      p.140

          .         .         .         .         .         .       g.37073
 GAAAAATTAGTTACACAGATCATAAAAAATCTTCAGGTGAAAATTTCCAGTATCCATATT       c.480
 E  K  L  V  T  Q  I  I  K  N  L  Q  V  K  I  S  S  I  H  I         p.160

          .      | 07  .         .         .         .         .    g.38216
 CGTTATGAAGATGAT | ATCACAAATCGGGACAAACCGCTGTCATTTGGTATTTCCCTTCAA    c.540
 R  Y  E  D  D   | I  T  N  R  D  K  P  L  S  F  G  I  S  L  Q      p.180

          .      | 08  .         .         .         .         .    g.40569
 AATCTGAGCATGCAG | ACAACTGATCAATACTGGGTTCCATGTTTACATGATGAAACTGAG    c.600
 N  L  S  M  Q   | T  T  D  Q  Y  W  V  P  C  L  H  D  E  T  E      p.200

          .      | 09  .         .         .         .         .    g.40834
 AAACTGGTTCGTAAG | TTAATCCGATTGGATAACCTGTTTGCCTATTGGAATGTGAAGTCT    c.660
 K  L  V  R  K   | L  I  R  L  D  N  L  F  A  Y  W  N  V  K  S      p.220

          .         .         .       | 10 .         .         .    g.41908
 CAGATGTTTTATCTTAGTGATTATGATAACTCCTTG | GACGACTTGAAGAATGGCATTGTC    c.720
 Q  M  F  Y  L  S  D  Y  D  N  S  L   | D  D  L  K  N  G  I  V      p.240

          .         .         .     | 11   .         .         .    g.47535
 AATGAAAATATTGTTCCAGAAGGTTATGATTTTG | TATTTCGTCCCATATCTGCTAATGCC    c.780
 N  E  N  I  V  P  E  G  Y  D  F  V |   F  R  P  I  S  A  N  A      p.260

          .         .         .         .         .         .       g.47595
 AAACTTGTGATGAATCGCCGATCTGATTTTGACTTTTCTGCCCCCAAAATAAACTTGGAA       c.840
 K  L  V  M  N  R  R  S  D  F  D  F  S  A  P  K  I  N  L  E         p.280

          .         .         .         .   | 12     .         .    g.47850
 ATTGAGTTACATAACATAGCAATTGAATTTAATAAACCACAG | TATTTCAGTATTATGGAG    c.900
 I  E  L  H  N  I  A  I  E  F  N  K  P  Q   | Y  F  S  I  M  E      p.300

          .         .         .         .         .         .       g.47910
 CTTCTTGAATCAGTTGATATGATGGCACAAAATCTGCCATATAGGAAGTTCAAACCTGAT       c.960
 L  L  E  S  V  D  M  M  A  Q  N  L  P  Y  R  K  F  K  P  D         p.320

          .         .          | 13        .         .         .    g.48771
 GTGCCTCTTCACCACCATGCCAGAGAATG | GTGGGCTTATGCTATACATGGCGTTCTTGAA    c.1020
 V  P  L  H  H  H  A  R  E  W  |  W  A  Y  A  I  H  G  V  L  E      p.340

          .         .         .         .         .         .       g.48831
 GTAAATGTTTGCCCCAGGTTATGGATGTGGTCATGGAAGCATATTAGAAAACATAGGCAA       c.1080
 V  N  V  C  P  R  L  W  M  W  S  W  K  H  I  R  K  H  R  Q         p.360

          .         .         .         .         .         .       g.48891
 AAAGTGAAGCAATATAAAGAACTGTATAAAAAAAAGTTAACAAGTAAGAAGCCACCTGGT       c.1140
 K  V  K  Q  Y  K  E  L  Y  K  K  K  L  T  S  K  K  P  P  G         p.380

          .         .  | 14      .         .         .         .    g.53520
 GAACTTCTCGTGTCTTTGGAG | GAGTTGGAAAAAACCTTGGATGTCTTTAATATAACTATA    c.1200
 E  L  L  V  S  L  E   | E  L  E  K  T  L  D  V  F  N  I  T  I      p.400

          .         .     | 15   .         .         .         .    g.54057
 GCTAGACAGACGGCAGAAGTTGAG | GTAAAGAAAGCTGGATACAAAATTTACAAAGAAGGA    c.1260
 A  R  Q  T  A  E  V  E   | V  K  K  A  G  Y  K  I  Y  K  E  G      p.420

          .         .         .         .         .         .       g.54117
 GTAAAAGATCCAGAGGATAATAAAGGGTGGTTTAGCTGGCTATGGTCTTGGTCAGAACAA       c.1320
 V  K  D  P  E  D  N  K  G  W  F  S  W  L  W  S  W  S  E  Q         p.440

          .         .         .        | 16.         .         .    g.54969
 AATACTAATGAACAGCAACCAGATGTTCAACCTGAAA | CTCTTGAAGAAATGTTGACACCT    c.1380
 N  T  N  E  Q  Q  P  D  V  Q  P  E  T |   L  E  E  M  L  T  P      p.460

          .         .         .         .         .         .       g.55029
 GAAGAAAAAGCTTTACTCTATGAAGCAATTGGCTATAGTGAAACAGCAGTTGATCCAACT       c.1440
 E  E  K  A  L  L  Y  E  A  I  G  Y  S  E  T  A  V  D  P  T         p.480

          .   | 17     .         .         .         .         .    g.55725
 TTACTAAAAACA | TTTGAAGCCTTGAAGTTTTTTGTCCACTTGAAAAGTATGTCTATTGTT    c.1500
 L  L  K  T   | F  E  A  L  K  F  F  V  H  L  K  S  M  S  I  V      p.500

          .         .         .         .         .         .       g.55785
 CTAAGAGAAAATCATCAAAAACCTGAGCTGGTAGATATTGTAATAGAAGAATTTAGCACC       c.1560
 L  R  E  N  H  Q  K  P  E  L  V  D  I  V  I  E  E  F  S  T         p.520

          .         .         .      | 18  .         .         .    g.65582
 TTAATTGTGCAAAGACCAGGAGCACAAGCAATAAA | ATTTGAAACTAAAATAGATTCATTT    c.1620
 L  I  V  Q  R  P  G  A  Q  A  I  K  |  F  E  T  K  I  D  S  F      p.540

          .         .         .         .         .         .       g.65642
 CATATTACTGGCTTACCAGATAATTCAGAAAAACCCCGCCTCCTGTCTTCATTGGATGAT       c.1680
 H  I  T  G  L  P  D  N  S  E  K  P  R  L  L  S  S  L  D  D         p.560

          .         .         .         .         .         .       g.65702
 GCAATGTCACTTTTCCAAATTACATTTGAGATAAATCCATTAGATGAAACTGTTTCTCAG       c.1740
 A  M  S  L  F  Q  I  T  F  E  I  N  P  L  D  E  T  V  S  Q         p.580

          .         .         .         .      | 19  .         .    g.65842
 AGGTGTATCATAGAAGCTGAACCTTTAGAAATCATATATGATGCA | AGGACAGTGAATAGT    c.1800
 R  C  I  I  E  A  E  P  L  E  I  I  Y  D  A   | R  T  V  N  S      p.600

          .         .         .         .         .         .       g.65902
 ATAGTGGAATTCTTCAGACCTCCAAAAGAGGTACATCTAGCACAGCTCACTGCAGCAACT       c.1860
 I  V  E  F  F  R  P  P  K  E  V  H  L  A  Q  L  T  A  A  T         p.620

          .         .         .         . | 20       .         .    g.74834
 TTGACAAAACTGGAAGAATTTCGCAGTAAGACAGCAACAG | GTCTACTGTATATTATTGAA    c.1920
 L  T  K  L  E  E  F  R  S  K  T  A  T  G |   L  L  Y  I  I  E      p.640

          .         .         .         .         .         .       g.74894
 ACACAGAAAGTTCTTGATCTCAAAATTAATTTGAAGGCTTCATATATTATTGTCCCACAA       c.1980
 T  Q  K  V  L  D  L  K  I  N  L  K  A  S  Y  I  I  V  P  Q         p.660

          .         .         .         .         .        | 21.    g.77655
 GATGGAATTTTTAGTCCTACATCAAATCTGCTTCTTTTGGACCTTGGTCATCTAAAG | GTG    c.2040
 D  G  I  F  S  P  T  S  N  L  L  L  L  D  L  G  H  L  K   | V      p.680

          .         .         .         .         .         .       g.77715
 ACGAGTAAAAGTCGTTCTGAATTACCAGATGTGAAACAAGGTGAGGCCAATCTTAAAGAG       c.2100
 T  S  K  S  R  S  E  L  P  D  V  K  Q  G  E  A  N  L  K  E         p.700

          .         .         .         .         .         .       g.77775
 ATAATGGATAGAGCTTATGATTCATTTGATATTCAACTTACAAGTGTACAGCTGCTTTAC       c.2160
 I  M  D  R  A  Y  D  S  F  D  I  Q  L  T  S  V  Q  L  L  Y         p.720

          . | 22       .         .         .         .         .    g.79840
 AGTAGAGTTG | GTGATAATTGGAGAGAAGCACGAAAACTCAGTGTATCTACCCAGCATATT    c.2220
 S  R  V  G |   D  N  W  R  E  A  R  K  L  S  V  S  T  Q  H  I      p.740

          .         .         .         .         .         .       g.79900
 TTGGTACCCATGCACTTCAATTTGGAACTGTCTAAGGCCATGGTTTTCATGGATGTAAGG       c.2280
 L  V  P  M  H  F  N  L  E  L  S  K  A  M  V  F  M  D  V  R         p.760

          | 23         .         .         .         .         .    g.87693
 ATGCCCAA | ATTCAAGATTTATGGAAAGTTACCTCTTATTTCTTTACGAATCTCAGATAAA    c.2340
 M  P  K  |  F  K  I  Y  G  K  L  P  L  I  S  L  R  I  S  D  K      p.780

          .         .         .         .         .         .       g.87753
 AAACTACAAGGGATTATGGAATTGATTGAAAGCATTCCAAAACCTGAACCAGTAACTGAA       c.2400
 K  L  Q  G  I  M  E  L  I  E  S  I  P  K  P  E  P  V  T  E         p.800

          .         .        | 24.         .         .         .    g.100868
 GTATCTGCCCCTGTCAAATCATTCCAG | ATTCAAACATCTACTTCTTTGGGAACATCACAG    c.2460
 V  S  A  P  V  K  S  F  Q   | I  Q  T  S  T  S  L  G  T  S  Q      p.820

          .         .         .         .         .   | 25     .    g.103061
 ATTTCACAGAAAATAATTCCTCTCTTGGAACTTCCATCTGTTTCTGAAGATG | ATTCAGAG    c.2520
 I  S  Q  K  I  I  P  L  L  E  L  P  S  V  S  E  D  D |   S  E      p.840

          .         .         .         .         .         .       g.103121
 GAGGAATTTTTTGATGCACCATGTAGTCCCTTGGAAGAACCTCTTCAGTTTCCAACTGGA       c.2580
 E  E  F  F  D  A  P  C  S  P  L  E  E  P  L  Q  F  P  T  G         p.860

          .         .         .         .         .         .       g.103181
 GTTAAAAGTATTCGAACCAGAAAGTTACAAAAGCAGGATTGTTCAGTAAATATGACTACA       c.2640
 V  K  S  I  R  T  R  K  L  Q  K  Q  D  C  S  V  N  M  T  T         p.880

          .         .        | 26.         .         .         .    g.103653
 TTTAAAATAAGATTTGAAGTACCAAAG | GTTTTGATCGAGTTTTATCACCTTGTTGGAGAT    c.2700
 F  K  I  R  F  E  V  P  K   | V  L  I  E  F  Y  H  L  V  G  D      p.900

          .         .         .         .         .         .       g.103713
 TGTGAACTATCTGTGGTAGAAATTCTTGTTTTAGGATTGGGTGCAGAAATTGAGATTAGA       c.2760
 C  E  L  S  V  V  E  I  L  V  L  G  L  G  A  E  I  E  I  R         p.920

          .         .         .         .         .         .       g.103773
 ACATACGATTTGAAAGCAAATGCCTTTTTGAAAGAGTTCTGCTTAAAATGCCCAGAATAC       c.2820
 T  Y  D  L  K  A  N  A  F  L  K  E  F  C  L  K  C  P  E  Y         p.940

      | 27   .         .         .         .         .         .    g.107770
 TTGG | ATGAAAACAAGAAACCAGTTTATTTGGTTACAACCCTGGATAACACAATGGAAGAC    c.2880
 L  D |   E  N  K  K  P  V  Y  L  V  T  T  L  D  N  T  M  E  D      p.960

          .         .     | 28   .         .         .         .    g.109458
 CTGTTAACGCTGGAATATGTAAAG | GCTGAAAAGAATGTACCCGACTTGAAAAGTACCTAT    c.2940
 L  L  T  L  E  Y  V  K   | A  E  K  N  V  P  D  L  K  S  T  Y      p.980

          .         .     | 29   .         .         .         .    g.109712
 AACAATGTTTTACAATTGATTAAG | GTAAATTTTTCCTCTTTGGATATTCATTTACACACT    c.3000
 N  N  V  L  Q  L  I  K   | V  N  F  S  S  L  D  I  H  L  H  T      p.1000

          .         .         .         .         .         .       g.109772
 GAAGCACTTCTGAATACAATAAATTATCTTCATAATATCCTTCCGCAATCAGAGGAAAAA       c.3060
 E  A  L  L  N  T  I  N  Y  L  H  N  I  L  P  Q  S  E  E  K         p.1020

          .         .         .         .         .         | 30    g.110912
 TCAGCCCCAGTGTCCACTACAGAGACTGAAGACAAAGGAGATGTCATTAAAAAATTAG | CT    c.3120
 S  A  P  V  S  T  T  E  T  E  D  K  G  D  V  I  K  K  L  A |       p.1040

          .         .         .         .         .         .       g.110972
 TTAAAACTATCCACAAATGAAGATATCATTACTTTGCAGATTTTAGCAGAATTATCGTGT       c.3180
 L  K  L  S  T  N  E  D  I  I  T  L  Q  I  L  A  E  L  S  C         p.1060

          .         .         .         .         .      | 31  .    g.111107
 TTACAGATCTTTATTCAAGATCAGAAATGTAACATTTCTGAAATTAAGATTGAAG | GGCTT    c.3240
 L  Q  I  F  I  Q  D  Q  K  C  N  I  S  E  I  K  I  E  G |   L      p.1080

          .         .         .         .         .         .       g.111167
 GATTCTGAGATGATTATGAGGCCTTCAGAAACTGAAATAAACGCAAAGCTAAGGAATATA       c.3300
 D  S  E  M  I  M  R  P  S  E  T  E  I  N  A  K  L  R  N  I         p.1100

          .         .         .          | 32        .         .    g.120917
 ATTGTTTTAGATTCTGATATAACAGCTATATACAAAAAG | GCTGTTTATATCACTGGAAAA    c.3360
 I  V  L  D  S  D  I  T  A  I  Y  K  K   | A  V  Y  I  T  G  K      p.1120

          .         .         .         .         .         .       g.120977
 GAAGTTTTCAGCTTCAAAATGGTTTCTTACATGGATGCAACTGCTGGTTCTGCATACACA       c.3420
 E  V  F  S  F  K  M  V  S  Y  M  D  A  T  A  G  S  A  Y  T         p.1140

          .         .         .         .         .         .       g.121037
 GATATGAATGTGGTTGACATTCAGGTTAATTTAATAGTTGGTTGCATTGAAGTAGTTTTT       c.3480
 D  M  N  V  V  D  I  Q  V  N  L  I  V  G  C  I  E  V  V  F         p.1160

          .         .        | 33.         .         .         .    g.123130
 GTCACGAAATTTCTATATTCTATATTG | GCTTTTATAGATAATTTTCAGGCAGCTAAACAA    c.3540
 V  T  K  F  L  Y  S  I  L   | A  F  I  D  N  F  Q  A  A  K  Q      p.1180

          .         .         .         .         .         .       g.123190
 GCCTTGGCTGAGGCAACTGTTCAGGCAGCTGGAATGGCTGCTACTGGTGTAAAAGAACTC       c.3600
 A  L  A  E  A  T  V  Q  A  A  G  M  A  A  T  G  V  K  E  L         p.1200

          .         .         .         .         .         .       g.123250
 GCACAAAGGAGTTCCAGAATGGCACTGGATATTAACATCAAAGCCCCAGTTGTGGTCATC       c.3660
 A  Q  R  S  S  R  M  A  L  D  I  N  I  K  A  P  V  V  V  I         p.1220

          .         .         .         .         .         .       g.123310
 CCGCAGTCTCCAGTTTCTGAAAATGTTTTTGTTGCTGATTTTGGACTAATTACAATGACA       c.3720
 P  Q  S  P  V  S  E  N  V  F  V  A  D  F  G  L  I  T  M  T         p.1240

          .         .         .         .         .         .       g.123370
 AATACCTTTCATATGATAACAGAGAGCCAGAGCTCTCCCCCACCTGTTATTGATTTGATA       c.3780
 N  T  F  H  M  I  T  E  S  Q  S  S  P  P  P  V  I  D  L  I         p.1260

          .         .         .   | 34     .         .         .    g.130498
 ACAATAAAGCTGAGTGAAATGCGACTATACAG | ATCTCGATTTATTAATGATGCATACCAG    c.3840
 T  I  K  L  S  E  M  R  L  Y  R  |  S  R  F  I  N  D  A  Y  Q      p.1280

          .         .         .         .         .         .       g.130558
 GAAGTACTGGATCTACTCCTGCCATTAAATCTTGAGGTTGTGGTTGAACGAAATTTATGC       c.3900
 E  V  L  D  L  L  L  P  L  N  L  E  V  V  V  E  R  N  L  C         p.1300

          .         .         .         .         .         .       g.130618
 TGGGAGTGGTACCAGGAAGTTCCTTGTTTTAATGTAAATGCTCAGCTGAAACCAATGGAG       c.3960
 W  E  W  Y  Q  E  V  P  C  F  N  V  N  A  Q  L  K  P  M  E         p.1320

  | 35       .         .         .         .         .         .    g.135560
  | TTCATTCTTAGTCAAGAAGATATAACAACTATTTTTAAAACATTGCATGGCAATATATGG    c.4020
  | F  I  L  S  Q  E  D  I  T  T  I  F  K  T  L  H  G  N  I  W      p.1340

          .         .         .         .         .         .       g.135620
 TATGAAAAAGATGGTAGTGCCTCACCTGCTGTAACAAAAGACCAATACAGTGCCACTAGT       c.4080
 Y  E  K  D  G  S  A  S  P  A  V  T  K  D  Q  Y  S  A  T  S         p.1360

          .         .         .     | 36   .         .         .    g.141573
 GGAGTTACTACTAATGCTTCACACCATTCAGGAG | GAGCAACTGTGGTGACAGCTGCTGTG    c.4140
 G  V  T  T  N  A  S  H  H  S  G  G |   A  T  V  V  T  A  A  V      p.1380

          .         .         .         .         .         .       g.141633
 GTAGAAGTACATTCACGTGCCTTACTAGTTAAGACAACACTAAACATAAGCTTCAAAACT       c.4200
 V  E  V  H  S  R  A  L  L  V  K  T  T  L  N  I  S  F  K  T         p.1400

          .         .         .         .   | 37     .         .    g.142068
 GATGATCTCACCATGGTGCTGTATAGTCCAGGTCCTAAACAG | GCTTCCTTTACAGATGTT    c.4260
 D  D  L  T  M  V  L  Y  S  P  G  P  K  Q   | A  S  F  T  D  V      p.1420

          .         .         .         .         .         .       g.142128
 CGTGATCCTTCTCTGAAACTTGCTGAATTTAAATTGGAGAATATTATAAGTACTTTAAAA       c.4320
 R  D  P  S  L  K  L  A  E  F  K  L  E  N  I  I  S  T  L  K         p.1440

          .         .         .         .         .         .       g.142188
 ATGTATACAGATGGCTCAACATTTTCTTCCTTCTCATTAAAAAACTGTATTTTAGATGAT       c.4380
 M  Y  T  D  G  S  T  F  S  S  F  S  L  K  N  C  I  L  D  D         p.1460

          .         .         .   | 38     .         .         .    g.142836
 AAAAGACCTCATGTCAAGAAAGCAACTCCTCG | AATGATAGGACTGACAGTTGGTTTTGAC    c.4440
 K  R  P  H  V  K  K  A  T  P  R  |  M  I  G  L  T  V  G  F  D      p.1480

          .         .         .         .         .         .       g.142896
 AAAAAAGACATGATGGATATAAAGTACAGGAAAGTCAGAGATGGTTGTGTGACTGATGCG       c.4500
 K  K  D  M  M  D  I  K  Y  R  K  V  R  D  G  C  V  T  D  A         p.1500

          .         .         .         .         .         .       g.142956
 GTCTTTCAAGAAATGTATATTTGTGCAAGCGTAGAATTTCTGCAGACTGTTGCAAATGTC       c.4560
 V  F  Q  E  M  Y  I  C  A  S  V  E  F  L  Q  T  V  A  N  V         p.1520

          .         .         .         .         .         .       g.143016
 TTTCTTGAGGCCTACACCACAGGCACTGCTGTAGAAACCAGTGTGCAAACATGGACTGCT       c.4620
 F  L  E  A  Y  T  T  G  T  A  V  E  T  S  V  Q  T  W  T  A         p.1540

          . | 39       .         .         .         .         .    g.143779
 AAGGAAGAAG | TACCTACACAGGAATCAGTGAAGTGGGAAATTAATGTTATTATTAAAAAT    c.4680
 K  E  E  V |   P  T  Q  E  S  V  K  W  E  I  N  V  I  I  K  N      p.1560

          .         .         .         .         .         .       g.143839
 CCTGAAATTGTGTTTGTAGCTGACATGACAAAAAATGATGCTCCTGCTTTAGTCATTACA       c.4740
 P  E  I  V  F  V  A  D  M  T  K  N  D  A  P  A  L  V  I  T         p.1580

          .         .         .         .         .         .       g.143899
 ACACAATGTGAAATTTGCTATAAAGGTAACCTTGAAAATAGTACAATGACTGCTGCCATT       c.4800
 T  Q  C  E  I  C  Y  K  G  N  L  E  N  S  T  M  T  A  A  I         p.1600

          .         .         .         .         .         .       g.143959
 AAAGATCTCCAAGTGAGAGCCTGCCCGTTTCTTCCAGTCAAGAGAAAAGGCAAAATCACT       c.4860
 K  D  L  Q  V  R  A  C  P  F  L  P  V  K  R  K  G  K  I  T         p.1620

     | 40    .         .         .         .         .         .    g.145218
 ACT | GTTTTGCAGCCCTGTGACTTGTTTTATCAAACTACTCAGAAAGGTACAGATCCACAA    c.4920
 T   | V  L  Q  P  C  D  L  F  Y  Q  T  T  Q  K  G  T  D  P  Q      p.1640

          .         .         .       | 41 .         .         .    g.145814
 GTGATCGATATGTCAGTAAAATCCCTGACACTAAAG | GTTTCACCAGTTATTATAAATACT    c.4980
 V  I  D  M  S  V  K  S  L  T  L  K   | V  S  P  V  I  I  N  T      p.1660

          .         .         .         .         .         .       g.145874
 ATGATTACCATAACTTCAGCACTGTATACAACTAAGGAAACCATCCCAGAAGAAACGGCT       c.5040
 M  I  T  I  T  S  A  L  Y  T  T  K  E  T  I  P  E  E  T  A         p.1680

          .         .         .         .         .         .       g.145934
 TCTTCTACTGCACATTTATGGGAAAAGAAGGATACAAAGACTTTAAAAATGTGGTTTCTT       c.5100
 S  S  T  A  H  L  W  E  K  K  D  T  K  T  L  K  M  W  F  L         p.1700

          .         .         .         .         .         .       g.145994
 GAAGAATCAAATGAAACTGAAAAAATAGCTCCCACAACTGAATTGGTACCCAAAGGCGAG       c.5160
 E  E  S  N  E  T  E  K  I  A  P  T  T  E  L  V  P  K  G  E         p.1720

          .         .         .         .         .         .       g.146054
 ATGATAAAAATGAACATTGATTCTATTTTTATAGTTCTTGAGGCTGGAATTGGTCATAGA       c.5220
 M  I  K  M  N  I  D  S  I  F  I  V  L  E  A  G  I  G  H  R         p.1740

          .         .         .         .         .         .       g.146114
 ACAGTACCTATGCTTCTGGCAAAGTCACGTTTTTCAGGGGAAGGCAAAAACTGGAGTTCC       c.5280
 T  V  P  M  L  L  A  K  S  R  F  S  G  E  G  K  N  W  S  S         p.1760

          .         .         .    | 42    .         .         .    g.147154
 CTAATAAATCTGCACTGTCAGCTTGAGCTAGAA | GTGCATTATTATAATGAAATGTTTGGT    c.5340
 L  I  N  L  H  C  Q  L  E  L  E   | V  H  Y  Y  N  E  M  F  G      p.1780

          .         .         .         .         .         .       g.147214
 GTATGGGAGCCTTTGCTTGAACCCTTAGAAATTGATCAGACTGAGGATTTTAGACCATGG       c.5400
 V  W  E  P  L  L  E  P  L  E  I  D  Q  T  E  D  F  R  P  W         p.1800

          .      | 43  .         .         .         .         .    g.148769
 AATCTTGGTATCAAG | ATGAAAAAGAAAGCAAAAATGGCCATTGTTGAGTCAGATCCTGAA    c.5460
 N  L  G  I  K   | M  K  K  K  A  K  M  A  I  V  E  S  D  P  E      p.1820

          .         .         .         .         .         .       g.148829
 GAAGAAAACTACAAAGTGCCAGAATATAAAACTGTCATCAGTTTCCATTCAAAAGACCAA       c.5520
 E  E  N  Y  K  V  P  E  Y  K  T  V  I  S  F  H  S  K  D  Q         p.1840

          .         .         .         .         .     | 44   .    g.149052
 TTAAACATTACATTATCCAAATGTGGTCTTGTAATGTTAAACAATTTAGTCAAG | GCATTT    c.5580
 L  N  I  T  L  S  K  C  G  L  V  M  L  N  N  L  V  K   | A  F      p.1860

          .         .         .         .         .         .       g.149112
 ACAGAAGCTGCCACTGGATCTTCAGCTGACTTCGTAAAGGATCTAGCACCATTTATGATT       c.5640
 T  E  A  A  T  G  S  S  A  D  F  V  K  D  L  A  P  F  M  I         p.1880

          .         .         .         .         .         .       g.149172
 TTAAATTCCCTTGGACTTACTATTTCTGTTTCGCCAAGTGATTCTTTTAGTGTACTCAAC       c.5700
 L  N  S  L  G  L  T  I  S  V  S  P  S  D  S  F  S  V  L  N         p.1900

          .         .         .         .         .         .       g.149232
 ATTCCTATGGCAAAATCATATGTATTGAAAAATGGAGAAAGTTTAAGTATGGATTATATC       c.5760
 I  P  M  A  K  S  Y  V  L  K  N  G  E  S  L  S  M  D  Y  I         p.1920

          .         .         .         .         .         .       g.149292
 CGAACCAAGGACAATGATCATTTCAATGCAATGACCAGCCTAAGCAGCAAACTCTTCTTC       c.5820
 R  T  K  D  N  D  H  F  N  A  M  T  S  L  S  S  K  L  F  F         p.1940

          . | 45       .         .         .         .         .    g.150672
 ATTCTTCTTA | CACCTGTTAACCATTCTACTGCTGATAAGATTCCTTTAACAAAAGTGGGA    c.5880
 I  L  L  T |   P  V  N  H  S  T  A  D  K  I  P  L  T  K  V  G      p.1960

          .         .         .         .         .         .       g.150732
 CGACGTCTGTACACTGTAAGACACAGAGAGTCTGGCGTTGAAAGATCTATTGTTTGTCAA       c.5940
 R  R  L  Y  T  V  R  H  R  E  S  G  V  E  R  S  I  V  C  Q         p.1980

          .         .         .         .         .  | 46      .    g.159574
 ATTGATACAGTAGAAGGAAGTAAGAAGGTCACAATTCGCTCCCCAGTGCAG | ATAAGAAAT    c.6000
 I  D  T  V  E  G  S  K  K  V  T  I  R  S  P  V  Q   | I  R  N      p.2000

          .         .         .         .         .         .       g.159634
 CATTTTTCAGTCCCACTGTCTGTTTACGAAGGGGATACCTTATTGGGAACTGCCTCACCT       c.6060
 H  F  S  V  P  L  S  V  Y  E  G  D  T  L  L  G  T  A  S  P         p.2020

          .         .         .      | 47  .         .         .    g.164835
 GAAAATGAATTCAACATACCATTAGGATCTTACCG | ATCATTCATTTTTCTGAAGCCAGAA    c.6120
 E  N  E  F  N  I  P  L  G  S  Y  R  |  S  F  I  F  L  K  P  E      p.2040

          .         .         .         .         .         .       g.164895
 GATGAGAACTATCAAATGTGTGAAGGAATTGACTTTGAAGAGATTATAAAAAATGATGGT       c.6180
 D  E  N  Y  Q  M  C  E  G  I  D  F  E  E  I  I  K  N  D  G         p.2060

          .         .         .         .         .         .       g.164955
 GCTCTTCTAAAGAAGAAATGTAGATCTAAAAACCCTTCTAAGGAATCATTTCTCATTAAT       c.6240
 A  L  L  K  K  K  C  R  S  K  N  P  S  K  E  S  F  L  I  N         p.2080

          .         .         .         .         .         .       g.165015
 ATTGTTCCAGAAAAAGATAATTTAACATCTCTATCAGTGTATTCAGAAGATGGTTGGGAT       c.6300
 I  V  P  E  K  D  N  L  T  S  L  S  V  Y  S  E  D  G  W  D         p.2100

          .         .         .         .         .         .       g.165075
 TTACCATACATAATGCATTTGTGGCCACCTATCCTGCTCCGAAATCTTCTTCCTTACAAA       c.6360
 L  P  Y  I  M  H  L  W  P  P  I  L  L  R  N  L  L  P  Y  K         p.2120

          .         | 48         .         .         .         .    g.167113
 ATTGCTTATTATATAGAG | GGAATTGAAAATTCGGTTTTTACTCTAAGTGAAGGACATTCA    c.6420
 I  A  Y  Y  I  E   | G  I  E  N  S  V  F  T  L  S  E  G  H  S      p.2140

          .         .         .         .         .         .       g.167173
 GCCCAGATTTGTACTGCACAGTTGGGTAAAGCCAGGCTACATTTAAAATTACTTGACTAT       c.6480
 A  Q  I  C  T  A  Q  L  G  K  A  R  L  H  L  K  L  L  D  Y         p.2160

          .         .         .         .         .         .       g.167233
 CTCAATCACGATTGGAAAAGTGAATATCACATAAAGCCTAATCAGCAAGACATTAGTTTT       c.6540
 L  N  H  D  W  K  S  E  Y  H  I  K  P  N  Q  Q  D  I  S  F         p.2180

          .         .         .         .         .         .       g.167293
 GTCAGTTTTACTTGTGTTACAGAAATGGAAAAGACTGATTTAGATATTGCTGTCCATATG       c.6600
 V  S  F  T  C  V  T  E  M  E  K  T  D  L  D  I  A  V  H  M         p.2200

          .         .         .         .         .         .       g.167353
 ACTTACAATACTGGTCAGACAGTTGTGGCATTTCATAGTCCTTATTGGATGGTCAATAAA       c.6660
 T  Y  N  T  G  Q  T  V  V  A  F  H  S  P  Y  W  M  V  N  K         p.2220

          .         .         .         .         .         .       g.167413
 ACTGGCCGCATGTTACAGTACAAAGCAGACGGAATTCATCGAAAGCATCCACCTAATTAT       c.6720
 T  G  R  M  L  Q  Y  K  A  D  G  I  H  R  K  H  P  P  N  Y         p.2240

          .         .         .         .         .     | 49   .    g.167739
 AAAAAGCCAGTTCTCTTTTCTTTTCAGCCAAATCACTTTTTTAATAACAATAAG | GTTCAA    c.6780
 K  K  P  V  L  F  S  F  Q  P  N  H  F  F  N  N  N  K   | V  Q      p.2260

          .         .         .         .         .         .       g.167799
 CTTATGGTAACTGATAGTGAGTTGTCCAATCAGTTTTCAATTGATACTGTTGGTAGTCAT       c.6840
 L  M  V  T  D  S  E  L  S  N  Q  F  S  I  D  T  V  G  S  H         p.2280

          .         .         .          | 50        .         .    g.167980
 GGAGCTGTTAAATGTAAAGGCCTGAAAATGGACTATCAA | GTTGGTGTCACTATAGACCTG    c.6900
 G  A  V  K  C  K  G  L  K  M  D  Y  Q   | V  G  V  T  I  D  L      p.2300

          .         .         .         .         .         .       g.168040
 AGCAGTTTTAACATTACTAGAATTGTGACATTTACCCCTTTTTATATGATTAAAAACAAA       c.6960
 S  S  F  N  I  T  R  I  V  T  F  T  P  F  Y  M  I  K  N  K         p.2320

          .         .         .         .         .         .       g.168100
 AGCAAATACCATATATCAGTGGCTGAAGAAGGAAATGATAAATGGCTCTCTCTTGATTTG       c.7020
 S  K  Y  H  I  S  V  A  E  E  G  N  D  K  W  L  S  L  D  L         p.2340

        | 51 .         .         .         .         .         .    g.171762
 GAGCAG | TGTATCCCCTTTTGGCCTGAGTATGCTTCTAGTAAACTTCTTATTCAAGTCGAA    c.7080
 E  Q   | C  I  P  F  W  P  E  Y  A  S  S  K  L  L  I  Q  V  E      p.2360

          .         .         .         .         .         .       g.171822
 AGGAGTGAAGATCCTCCCAAAAGGATATATTTTAACAAGCAGGAAAATTGTATTCTATTG       c.7140
 R  S  E  D  P  P  K  R  I  Y  F  N  K  Q  E  N  C  I  L  L         p.2380

          .      | 52  .         .         .         .         .    g.172609
 CGTCTAGATAACGAG | CTTGGAGGTATTATAGCAGAAGTGAATTTGGCCGAGCATTCTACA    c.7200
 R  L  D  N  E   | L  G  G  I  I  A  E  V  N  L  A  E  H  S  T      p.2400

          .         .         .         .         .         .       g.172669
 GTTATTACATTTTTAGATTATCATGATGGAGCAGCTACATTCCTCTTAATAAATCACACA       c.7260
 V  I  T  F  L  D  Y  H  D  G  A  A  T  F  L  L  I  N  H  T         p.2420

          .         .          | 53        .         .         .    g.178903
 AAGAATGAACTTGTTCAATACAATCAAAG | TTCTCTCAGTGAAATAGAAGATTCCCTCCCT    c.7320
 K  N  E  L  V  Q  Y  N  Q  S  |  S  L  S  E  I  E  D  S  L  P      p.2440

          .         .         .         .         .         .       g.178963
 CCTGGTAAAGCCGTGTTTTATACATGGGCTGATCCGGTGGGCTCTAGAAGGCTGAAGTGG       c.7380
 P  G  K  A  V  F  Y  T  W  A  D  P  V  G  S  R  R  L  K  W         p.2460

          .         .         .          | 54        .         .    g.180985
 AGATGTAGAAAAAGCCATGGTGAAGTAACACAGAAGGAT | GATATGATGATGCCTATAGAT    c.7440
 R  C  R  K  S  H  G  E  V  T  Q  K  D   | D  M  M  M  P  I  D      p.2480

          .         .         .         .         .         .       g.181045
 TTGGGGGAAAAGACAATATATTTAGTTTCATTCTTTGAAGGTTTACAACGCATTATTTTA       c.7500
 L  G  E  K  T  I  Y  L  V  S  F  F  E  G  L  Q  R  I  I  L         p.2500

          .         .         .         .         .         .       g.181105
 TTCACTGAAGATCCAAGGGTATTTAAAGTAACATATGAAAGTGAGAAAGCAGAGTTAGCA       c.7560
 F  T  E  D  P  R  V  F  K  V  T  Y  E  S  E  K  A  E  L  A         p.2520

          .         .         .         .         .         .       g.181165
 GAGCAAGAAATTGCAGTGGCATTACAAGATGTTGGAATTTCTCTTGTCAACAATTACACG       c.7620
 E  Q  E  I  A  V  A  L  Q  D  V  G  I  S  L  V  N  N  Y  T         p.2540

          .         .         .   | 55     .         .         .    g.184297
 AAGCAAGAAGTAGCCTATATAGGCATTACAAG | TTCTGATGTGGTTTGGGAAACAAAGCCC    c.7680
 K  Q  E  V  A  Y  I  G  I  T  S  |  S  D  V  V  W  E  T  K  P      p.2560

          .         .         .         .         .         .       g.184357
 AAGAAGAAGGCAAGATGGAAGCCAATGAGTGTAAAGCACACTGAGAAGTTAGAGAGAGAA       c.7740
 K  K  K  A  R  W  K  P  M  S  V  K  H  T  E  K  L  E  R  E         p.2580

          .         .         .         .         .         .       g.184417
 TTTAAGGAATATACTGAATCTTCTCCTTCAGAAGATAAGGTTATTCAGTTGGACACTAAT       c.7800
 F  K  E  Y  T  E  S  S  P  S  E  D  K  V  I  Q  L  D  T  N         p.2600

        | 56 .         .         .         .         .         .    g.185301
 GTTCCG | GTTCGCCTAACCCCTACTGGTCATAACATGAAAATTCTGCAGCCGCATGTAATA    c.7860
 V  P   | V  R  L  T  P  T  G  H  N  M  K  I  L  Q  P  H  V  I      p.2620

          .         .         .         .         .         .       g.185361
 GCTCTACGAAGAAATTATCTTCCAGCATTAAAAGTGGAATATAACACATCTGCACATCAA       c.7920
 A  L  R  R  N  Y  L  P  A  L  K  V  E  Y  N  T  S  A  H  Q         p.2640

          .         .         .    | 57    .         .         .    g.185939
 TCATCATTTAGAATTCAGATTTACAGAATACAG | ATCCAAAATCAGATACATGGTGCTGTA    c.7980
 S  S  F  R  I  Q  I  Y  R  I  Q   | I  Q  N  Q  I  H  G  A  V      p.2660

          .         .         .         .         .      | 58  .    g.186893
 TTTCCCTTTGTGTTTTATCCTGTTAAACCTCCAAAGTCGGTCACCATGGATTCAG | CACCA    c.8040
 F  P  F  V  F  Y  P  V  K  P  P  K  S  V  T  M  D  S  A |   P      p.2680

          .         .         .         .         .         .       g.186953
 AAGCCCTTTACAGATGTCAGTATTGTCATGAGATCTGCAGGACATTCCCAGATATCACGT       c.8100
 K  P  F  T  D  V  S  I  V  M  R  S  A  G  H  S  Q  I  S  R         p.2700

       | 59  .         .         .         .         .         .    g.188146
 ATTAA | GTATTTCAAAGTATTGATTCAAGAAATGGATCTCAGGTTAGATCTTGGGTTTATC    c.8160
 I  K  |  Y  F  K  V  L  I  Q  E  M  D  L  R  L  D  L  G  F  I      p.2720

          .         .         .         .         .  | 60      .    g.193024
 TATGCTTTAACAGACCTTATGACAGAAGCTGAGGTGACTGAAAATACAGAG | GTTGAGCTT    c.8220
 Y  A  L  T  D  L  M  T  E  A  E  V  T  E  N  T  E   | V  E  L      p.2740

          .         .         .         .         .         .       g.193084
 TTTCATAAAGATATAGAAGCTTTCAAAGAAGAATATAAAACAGCCTCATTAGTAGATCAA       c.8280
 F  H  K  D  I  E  A  F  K  E  E  Y  K  T  A  S  L  V  D  Q         p.2760

          .         .         .         .      | 61  .         .    g.194297
 TCACAAGTCAGCCTCTATGAATATTTTCATATATCTCCTATCAAG | TTACATTTAAGTGTT    c.8340
 S  Q  V  S  L  Y  E  Y  F  H  I  S  P  I  K   | L  H  L  S  V      p.2780

          .         .         .         .         .         .       g.194357
 TCACTGAGTTCCGGCAGAGAAGAAGCTAAAGATTCAAAACAAAATGGAGGACTGATTCCA       c.8400
 S  L  S  S  G  R  E  E  A  K  D  S  K  Q  N  G  G  L  I  P         p.2800

          .         .         .         .         .         .       g.194417
 GTTCATTCTTTAAATCTTTTGCTGAAGAGTATTGGTGCCACACTGACAGATGTACAAGAT       c.8460
 V  H  S  L  N  L  L  L  K  S  I  G  A  T  L  T  D  V  Q  D         p.2820

          .  | 62      .         .         .         .         .    g.195659
 GTAGTTTTTAA | GCTTGCATTTTTTGAACTCAACTATCAGTTCCATACAACATCCGATCTA    c.8520
 V  V  F  K  |  L  A  F  F  E  L  N  Y  Q  F  H  T  T  S  D  L      p.2840

          .         .         .    | 63    .         .         .    g.196881
 CAGTCTGAAGTCATAAGACACTATTCAAAACAG | GCCATTAAGCAGATGTATGTACTCATT    c.8580
 Q  S  E  V  I  R  H  Y  S  K  Q   | A  I  K  Q  M  Y  V  L  I      p.2860

          .         .         .         .         .         .       g.196941
 CTTGGACTTGATGTTTTGGGAAATCCATTTGGCTTAATTAGAGAATTTTCTGAAGGTGTA       c.8640
 L  G  L  D  V  L  G  N  P  F  G  L  I  R  E  F  S  E  G  V         p.2880

          .         .        | 64.         .         .         .    g.197845
 GAAGCATTTTTTTATGAACCTTACCAG | GGAGCCATCCAGGGTCCTGAAGAGTTTGTGGAA    c.8700
 E  A  F  F  Y  E  P  Y  Q   | G  A  I  Q  G  P  E  E  F  V  E      p.2900

          .         .         .         .    | 65    .         .    g.197987
 GGAATGGCACTAGGACTTAAGGCACTAGTTGGTGGAGCTGTTG | GTGGATTGGCTGGTGCT    c.8760
 G  M  A  L  G  L  K  A  L  V  G  G  A  V  G |   G  L  A  G  A      p.2920

          .         .         .         .         .         .       g.198047
 GCCTCCAAAATCACCGGTGCTATGGCTAAGGGGGTAGCAGCTATGACCATGGATGAAGAC       c.8820
 A  S  K  I  T  G  A  M  A  K  G  V  A  A  M  T  M  D  E  D         p.2940

          .         .         .         .         .         .       g.198107
 TACCAACAGAAGAGAAGAGAAGCCATGAATAAGCAACCAGCTGGTTTTAGAGAAGGCATC       c.8880
 Y  Q  Q  K  R  R  E  A  M  N  K  Q  P  A  G  F  R  E  G  I         p.2960

          .         .        | 66.         .         .         .    g.198478
 ACTCGTGGAGGAAAAGGCTTAGTTTCT | GGATTTGTTAGTGGCATAACAGGAATTGTTACA    c.8940
 T  R  G  G  K  G  L  V  S   | G  F  V  S  G  I  T  G  I  V  T      p.2980

          .    | 67    .         .         .         .         .    g.198628
 AAACCAATCAAAG | GAGCTCAAAAAGGAGGAGCAGCTGGTTTCTTTAAAGGTGTTGGGAAA    c.9000
 K  P  I  K  G |   A  Q  K  G  G  A  A  G  F  F  K  G  V  G  K      p.3000

          .         .         .         .         .         .       g.198688
 GGTTTAGTAGGAGCGGTAGCAAGGCCAACTGGAGGCATCATAGACATGGCTAGCAGTACA       c.9060
 G  L  V  G  A  V  A  R  P  T  G  G  I  I  D  M  A  S  S  T         p.3020

          .        | 68.         .         .         .         .    g.209574
 TTTCAGGGAATAAAAAG | AGCTACAGAGACTTCTGAAGTGGAGAGTCTGCGACCTCCTCGG    c.9120
 F  Q  G  I  K  R  |  A  T  E  T  S  E  V  E  S  L  R  P  P  R      p.3040

          .         .         .         .         .         .       g.209634
 TTCTTCAATGAAGATGGAGTTATCAGACCGTACAGGTTGAGGGATGGGACTGGAAATCAA       c.9180
 F  F  N  E  D  G  V  I  R  P  Y  R  L  R  D  G  T  G  N  Q         p.3060

           | 69        .         .         .         .         .    g.230842
 ATGTTACAG | GTCATGGAAAATGGAAGATTTGCAAAATACAAATATTTTACCCATGTCATG    c.9240
 M  L  Q   | V  M  E  N  G  R  F  A  K  Y  K  Y  F  T  H  V  M      p.3080

          .         .         .      | 70  .         .         .    g.233444
 ATCAATAAGACAGATATGCTAATGATAACCAGACG | TGGTGTATTGTTTGTAACAAAGGGA    c.9300
 I  N  K  T  D  M  L  M  I  T  R  R  |  G  V  L  F  V  T  K  G      p.3100

          .         .         .         .         .         .       g.233504
 ACATTTGGACAACTCACGTGTGAGTGGCAGTATAGTTTTGATGAATTTACCAAAGAGCCA       c.9360
 T  F  G  Q  L  T  C  E  W  Q  Y  S  F  D  E  F  T  K  E  P         p.3120

          .         .         .          | 71        .         .    g.235109
 TTCATTGTTCATGGGAGAAGATTGCGCATTGAAGCAAAG | GAACGAGTGAAGTCTGTATTT    c.9420
 F  I  V  H  G  R  R  L  R  I  E  A  K   | E  R  V  K  S  V  F      p.3140

          .         .         .         .         .     | 72   .    g.243517
 CATGCCAGAGAGTTTGGAAAAATAATTAACTTCAAGACCCCAGAGGATGCCAGG | TGGATC    c.9480
 H  A  R  E  F  G  K  I  I  N  F  K  T  P  E  D  A  R   | W  I      p.3160

          .         .         .         .                           g.243562
 CTCACAAAGCTACAAGAAGCAAGAGAACCTTCTCCGAGCCTCTGA                      c.9525
 L  T  K  L  Q  E  A  R  E  P  S  P  S  L  X                        p.3174

          .         .         .         .         .         .       g.243622
 cagagaacactgcctgaagacacacagcaataagtgattacagctcctagactaccttcc       c.*60

          .         .         .         .         .         .       g.243682
 aaaacctgtttgggaagcatattacagaaatgatttcaagtaccctgtattctggatgct       c.*120

          .         .         .         .         .         .       g.243742
 aaaaaacaaaaacaaacaaaaaaacaaaaacaaaaaaacaaaaccagaatcaggtaaaac       c.*180

          .         .         .         .         .         .       g.243802
 agctatgtgattaaaatattttaattcttcagcaattacccggttttctaaattgaatca       c.*240

          .         .         .         .         .         .       g.243862
 tgcatctatttataattctaattattttgtaaaagaagacaaaattatgaatcttaagta       c.*300

          .         .         .         .         .         .       g.243922
 tttgctccatctttttctctgtaatggtggagaggctgcccataattcatctccacatgg       c.*360

          .         .         .         .         .         .       g.243982
 agccaagtttaatgtttctagttcacattttgtacttctgtcatgcttatttcaaactcc       c.*420

          .         .         .         .         .         .       g.244042
 ctgagtgatgggtaagaaatcaaacattgcctcagtggtatcaagagaactttggtggtg       c.*480

          .         .         .         .         .         .       g.244102
 gtttcttcagaatcatgaagttcttttgccagataaatattttgatattattttcctttt       c.*540

          .         .         .         .         .         .       g.244162
 taatataaaggataggtttgaattgtacttaaaatgcatagcattattaaaaacaatctt       c.*600

          .         .         .         .         .         .       g.244222
 ttaaaatataatttataacatagattgaagcctccccttaagaaaccttaaagaaataag       c.*660

          .         .         .         .         .         .       g.244282
 tatcctactcaaaaaaggaagtctgtttcagaactttagggcctttgaaatatttcctca       c.*720

          .         .         .         .         .         .       g.244342
 agcctatttcatgagatctacttggtttacccaagtcatgtttttaatagactgctaata       c.*780

          .         .         .         .         .         .       g.244402
 tcaaaggagaatttttaaagccttaacaatgcctactttccattcactgttaacatggaa       c.*840

          .         .         .         .         .         .       g.244462
 taaacacaattcccaacatcttagatagtgtattatgcttccaacagacagtccctctca       c.*900

          .         .         .         .         .         .       g.244522
 tataaagtttatgtaccctaaaatctaacccaataacctgtcccgttgccaatagattga       c.*960

          .         .         .         .         .         .       g.244582
 gaatttctggtttgcttactctacagttattcaaatgagagtcacgcttttaaatttaca       c.*1020

          .         .         .         .         .         .       g.244642
 gctcatcacagaaatcatcagctatacattagtaaaaataaggacatgaggttttctttc       c.*1080

          .         .         .         .         .         .       g.244702
 ttggtttttgtccaagatctttgcaccttaatattaatggactgtttcaggtaaaagaga       c.*1140

          .         .         .         .         .         .       g.244762
 atgaatgtatgattgtgaactgtgaagagaatgatgcaggatcctatttagttactgaat       c.*1200

          .         .         .         .         .         .       g.244822
 aatacagagtattcaatgcatgttgtatgtgccaccaagttactattaactgtttttgga       c.*1260

          .         .         .         .         .         .       g.244882
 attgaagactctgtatagtcaatagttgtgaaattcttctcaggctccttaaaccctcgc       c.*1320

          .         .         .         .         .         .       g.244942
 tttgttgtaaaagctaaaataaacagcatgctatattgtaattgtatttcttgctgacca       c.*1380

          .         .         .         .         .         .       g.245002
 aatctactaaatgctattgatttctctctgattactaaaacacattgtttattctcagta       c.*1440

          .         .         .                                     g.245039
 gtttcccccaaaatgcttttttctttgctgaacttaa                              c.*1477

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Vacuolar protein sorting 13 homolog A (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center