WNK lysine deficient protein kinase 1 (WNK1) - coding DNA reference sequence

(used for variant description)

(last modified January 19, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_018979.3 in the WNK1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007984.3, covering WNK1 transcript NM_018979.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.4907
                  ccggcccttcgcctctgggcgatgggcgacctgtgaggccggt       c.-601

 .         .         .         .         .         .                g.4967
 ccccatcgctgggggcgcgtgtgggaggaggcggccgcccgagtgaccgggagccgggcc       c.-541

 .         .         .         .         .         .                g.5027
 gcggccttccctcgcccgcctcggcccctcccactcctctgccccggggccgccaccgcc       c.-481

 .         .         .         .         .         .                g.5087
 cgggcgtcggacctggtcccgtgctcgcggtgccgccgccctctgggcctagcccgccca       c.-421

 .         .         .         .         .         .                g.5147
 gctcggcgagcggcggcagtgggagccgcgtccgccgcatccgcctcgactcggtgccgg       c.-361

 .         .         .         .         .         .                g.5207
 cccctggccctcccctcatgactgcggcgcctctgctgccaccgcccgcccggccgccgc       c.-301

 .         .         .         .         .         .                g.5267
 tcgccgcaggatggatgcggaccgtgcggcgctaacccccgtggctcagctcccgaatcg       c.-241

 .         .         .         .         .         .                g.5327
 cccgccttcgagccctcctcgtgagccgcagcagcctcggtgccagcccccgccgcagct       c.-181

 .         .         .         .         .         .                g.5387
 gggcccagcggtccgcctgtccctcgttgcggcttgtcggtgctgagtgaggcgtcgtcc       c.-121

 .         .         .         .         .         .                g.5447
 gggtcggcgcgaacccgcccggccgcggttccctgcagacctctgcgcgggcggctcggc       c.-61

 .         .         .         .         .         .                g.5507
 ccttcacgcccttttcgttcacgaatccgagcccgctcgcctctctccagcgaaccgacc       c.-1

          .         .         .         .         .         .       g.5567
 ATGTCTGGCGGCGCCGCAGAGAAGCAGAGCAGCACTCCCGGTTCCCTGTTCCTCTCGCCG       c.60
 M  S  G  G  A  A  E  K  Q  S  S  T  P  G  S  L  F  L  S  P         p.20

          .         .         .         .         .         .       g.5627
 CCGGCTCCTGCCCCCAAGAATGGCTCCAGCTCCGATTCCTCCGTGGGGGAGAAACTGGGA       c.120
 P  A  P  A  P  K  N  G  S  S  S  D  S  S  V  G  E  K  L  G         p.40

          .         .         .         .         .         .       g.5687
 GCCGCGGCCGCCGACGCTGTGACCGGCAGGACCGAGGAGTACAGGCGCCGCCGCCACACT       c.180
 A  A  A  A  D  A  V  T  G  R  T  E  E  Y  R  R  R  R  H  T         p.60

          .         .         .         .         .         .       g.5747
 ATGGACAAGGACAGCCGTGGGGCGGCCGCGACCACTACCACCACTGAGCACCGCTTCTTC       c.240
 M  D  K  D  S  R  G  A  A  A  T  T  T  T  T  E  H  R  F  F         p.80

          .         .         .         .         .         .       g.5807
 CGCCGGAGCGTCATCTGTGACTCCAATGCCACTGCACTGGAGCTTCCCGGCCTTCCTCTT       c.300
 R  R  S  V  I  C  D  S  N  A  T  A  L  E  L  P  G  L  P  L         p.100

          .         .         .         .         .         .       g.5867
 TCCCTGCCCCAGCCCAGCATCCCCGCGGCTGTCCCGCAGAGTGCTCCACCGGAGCCCCAC       c.360
 S  L  P  Q  P  S  I  P  A  A  V  P  Q  S  A  P  P  E  P  H         p.120

          .         .         .         .         .         .       g.5927
 CGGGAAGAGACCGTGACCGCCACCGCCACTTCCCAGGTAGCCCAGCAGCCTCCAGCCGCT       c.420
 R  E  E  T  V  T  A  T  A  T  S  Q  V  A  Q  Q  P  P  A  A         p.140

          .         .         .         .         .         .       g.5987
 GCCGCCCCTGGGGAACAGGCCGTCGCGGGCCCTGCCCCCTCGACTGTCCCCAGCAGTACC       c.480
 A  A  P  G  E  Q  A  V  A  G  P  A  P  S  T  V  P  S  S  T         p.160

          .         .         .         .         .         .       g.6047
 AGCAAAGACCGCCCAGTGTCCCAGCCTAGCCTTGTGGGGAGCAAAGAGGAGCCGCCGCCG       c.540
 S  K  D  R  P  V  S  Q  P  S  L  V  G  S  K  E  E  P  P  P         p.180

          .         .         .         .         .         .       g.6107
 GCGAGAAGTGGCAGCGGCGGCGGCAGCGCCAAGGAGCCACAGGAGGAACGGAGCCAGCAG       c.600
 A  R  S  G  S  G  G  G  S  A  K  E  P  Q  E  E  R  S  Q  Q         p.200

          .         .         .         .         .         .       g.6167
 CAGGATGATATCGAAGAGCTGGAGACCAAGGCCGTGGGAATGTCTAACGATGGCCGCTTT       c.660
 Q  D  D  I  E  E  L  E  T  K  A  V  G  M  S  N  D  G  R  F         p.220

          .         .         .         .         .         .       g.6227
 CTCAAGTTTGACATCGAAATCGGCAGAGGCTCCTTTAAGACGGTCTACAAAGGTCTGGAC       c.720
 L  K  F  D  I  E  I  G  R  G  S  F  K  T  V  Y  K  G  L  D         p.240

          .         .         .          | 02        .         .    g.65604
 ACTGAAACCACCGTGGAAGTCGCCTGGTGTGAACTGCAG | GATCGAAAATTAACAAAGTCT    c.780
 T  E  T  T  V  E  V  A  W  C  E  L  Q   | D  R  K  L  T  K  S      p.260

          .         .         .         .         .         .       g.65664
 GAGAGGCAGAGATTTAAAGAAGAAGCTGAAATGTTAAAAGGTCTTCAGCATCCCAATATT       c.840
 E  R  Q  R  F  K  E  E  A  E  M  L  K  G  L  Q  H  P  N  I         p.280

          .         .         .         .         .         .       g.65724
 GTTAGATTTTATGATTCCTGGGAATCCACAGTAAAAGGAAAGAAGTGCATTGTTTTGGTG       c.900
 V  R  F  Y  D  S  W  E  S  T  V  K  G  K  K  C  I  V  L  V         p.300

          .         .         .   | 03     .         .         .    g.79011
 ACTGAACTTATGACGTCTGGAACACTTAAAAC | GTATCTGAAAAGGTTTAAAGTGATGAAG    c.960
 T  E  L  M  T  S  G  T  L  K  T  |  Y  L  K  R  F  K  V  M  K      p.320

          .         .         .         .         .         .       g.79071
 ATCAAAGTTCTAAGAAGCTGGTGCCGTCAGATCCTTAAAGGTCTTCAGTTTCTTCATACT       c.1020
 I  K  V  L  R  S  W  C  R  Q  I  L  K  G  L  Q  F  L  H  T         p.340

          .         .         .         .         .         .       g.79131
 CGAACTCCACCTATCATTCACCGCGATCTTAAATGTGACAACATCTTTATCACCGGCCCT       c.1080
 R  T  P  P  I  I  H  R  D  L  K  C  D  N  I  F  I  T  G  P         p.360

          .         .         .         .         .         .       g.79191
 ACTGGCTCAGTCAAGATTGGAGACCTCGGTCTGGCAACCCTGAAGCGGGCTTCTTTTGCC       c.1140
 T  G  S  V  K  I  G  D  L  G  L  A  T  L  K  R  A  S  F  A         p.380

          .    | 04    .         .         .         .         .    g.81991
 AAGAGTGTGATAG | GTACCCCAGAGTTCATGGCCCCTGAGATGTATGAGGAGAAATATGAT    c.1200
 K  S  V  I  G |   T  P  E  F  M  A  P  E  M  Y  E  E  K  Y  D      p.400

          .         .         .         .         .         .       g.82051
 GAATCCGTTGACGTTTATGCTTTTGGGATGTGCATGCTTGAGATGGCTACATCTGAATAT       c.1260
 E  S  V  D  V  Y  A  F  G  M  C  M  L  E  M  A  T  S  E  Y         p.420

          .         .         .         .         .  | 05      .    g.109111
 CCTTACTCGGAGTGCCAAAATGCTGCACAGATCTACCGTCGCGTGACCAGT | GGGGTGAAG    c.1320
 P  Y  S  E  C  Q  N  A  A  Q  I  Y  R  R  V  T  S   | G  V  K      p.440

          .         .         .         .         .         .       g.109171
 CCAGCCAGTTTTGACAAAGTAGCAATTCCTGAAGTGAAGGAAATTATTGAAGGATGCATA       c.1380
 P  A  S  F  D  K  V  A  I  P  E  V  K  E  I  I  E  G  C  I         p.460

          .         . | 06       .         .         .         .    g.111226
 CGACAAAACAAAGATGAAAG | ATATTCCATCAAAGACCTTTTGAACCATGCCTTCTTCCAA    c.1440
 R  Q  N  K  D  E  R  |  Y  S  I  K  D  L  L  N  H  A  F  F  Q      p.480

          .         .         .         .         .         .       g.111286
 GAGGAAACAGGAGTACGGGTAGAATTAGCAGAAGAAGATGATGGAGAAAAAATAGCCATA       c.1500
 E  E  T  G  V  R  V  E  L  A  E  E  D  D  G  E  K  I  A  I         p.500

          .         .         .         .         .         .       g.111346
 AAATTATGGCTACGTATTGAAGATATTAAGAAATTAAAGGGAAAATACAAAGATAATGAA       c.1560
 K  L  W  L  R  I  E  D  I  K  K  L  K  G  K  Y  K  D  N  E         p.520

          .         .         .         .         .         .       g.111406
 GCTATTGAGTTTTCTTTTGATTTAGAGAGAGATGTCCCAGAAGATGTTGCACAAGAAATG       c.1620
 A  I  E  F  S  F  D  L  E  R  D  V  P  E  D  V  A  Q  E  M         p.540

  | 07       .         .         .         .         .         .    g.113014
  | GTAGAGTCTGGGTATGTCTGTGAAGGTGATCACAAGACCATGGCTAAAGCTATCAAAGAC    c.1680
  | V  E  S  G  Y  V  C  E  G  D  H  K  T  M  A  K  A  I  K  D      p.560

          .         .         .         .         .         .       g.113074
 AGAGTATCATTAATTAAGAGGAAACGAGAGCAGCGGCAGTTGGTACGGGAGGAGCAAGAA       c.1740
 R  V  S  L  I  K  R  K  R  E  Q  R  Q  L  V  R  E  E  Q  E         p.580

          .         .         .         .         .         .       g.113134
 AAAAAAAAGCAGGAAGAGAGCAGTCTCAAACAGCAGGTAGAACAATCCAGTGCTTCCCAG       c.1800
 K  K  K  Q  E  E  S  S  L  K  Q  Q  V  E  Q  S  S  A  S  Q         p.600

          .         .         .         .         .         .       g.113194
 ACAGGAATCAAGCAGCTCCCTTCTGCTAGCACCGGCATACCTACTGCTTCTACCACTTCA       c.1860
 T  G  I  K  Q  L  P  S  A  S  T  G  I  P  T  A  S  T  T  S         p.620

          .         .         .         .         .         .       g.113254
 GCTTCAGTTTCTACACAAGTAGAACCTGAAGAACCTGAGGCAGATCAACATCAACAACTA       c.1920
 A  S  V  S  T  Q  V  E  P  E  E  P  E  A  D  Q  H  Q  Q  L         p.640

          .         .         .  | 08      .         .         .    g.114053
 CAGTACCAGCAACCCAGTATATCTGTGTTAT | CTGATGGGACGGTTGACAGTGGTCAGGGA    c.1980
 Q  Y  Q  Q  P  S  I  S  V  L  S |   D  G  T  V  D  S  G  Q  G      p.660

          .         .         .         .         .         .       g.114113
 TCCTCTGTCTTCACAGAATCTCGAGTGAGCAGCCAACAGACAGTTTCATATGGTTCCCAA       c.2040
 S  S  V  F  T  E  S  R  V  S  S  Q  Q  T  V  S  Y  G  S  Q         p.680

          .         .         .         .         .         .       g.114173
 CATGAACAGGCACATTCTACAGGCACAGTCCCAGGGCATATACCTTCTACTGTCCAAGCA       c.2100
 H  E  Q  A  H  S  T  G  T  V  P  G  H  I  P  S  T  V  Q  A         p.700

          .         .         .          | 09        .         .    g.123227
 CAGTCTCAGCCCCATGGGGTATATCCACCCTCAAGTGTG | GCACAGGGGCAGAGCCAGGGT    c.2160
 Q  S  Q  P  H  G  V  Y  P  P  S  S  V   | A  Q  G  Q  S  Q  G      p.720

          .         .         .         .         .         .       g.123287
 CAGCCATCCTCAAGTAGCTTAACAGGGGTTTCATCTTCCCAACCCATACAACATCCTCAG       c.2220
 Q  P  S  S  S  S  L  T  G  V  S  S  S  Q  P  I  Q  H  P  Q         p.740

     | 10    .         .         .         .         .         .    g.130210
 CAG | CAGCAGGGAATACAGCAGACAGCCCCTCCTCAACAGACAGTGCAGTATTCACTTTCA    c.2280
 Q   | Q  Q  G  I  Q  Q  T  A  P  P  Q  Q  T  V  Q  Y  S  L  S      p.760

          .         .         .         .         .         .       g.130270
 CAGACATCAACCTCCAGTGAGGCCACTACTGCACAGCCAGTGAGTCAGCCTCAAGCTCCA       c.2340
 Q  T  S  T  S  S  E  A  T  T  A  Q  P  V  S  Q  P  Q  A  P         p.780

          .         .         .    | 11    .         .         .    g.131541
 CAAGTCTTGCCTCAAGTATCAGCTGGAAAACAG | CTTCCAGTTTCCCAGCCAGTACCAACT    c.2400
 Q  V  L  P  Q  V  S  A  G  K  Q   | L  P  V  S  Q  P  V  P  T      p.800

          .         .         .         .         .         .       g.131601
 ATCCAAGGCGAACCTCAGATCCCAGTTGCGACACAACCCTCGGTTGTTCCAGTCCACTCT       c.2460
 I  Q  G  E  P  Q  I  P  V  A  T  Q  P  S  V  V  P  V  H  S         p.820

          .         .         .         .         .         .       g.131661
 GGTGCTCATTTCCTTCCAGTGGGACAGCCGCTCCCTACTCCCTTGCTCCCTCAGTACCCT       c.2520
 G  A  H  F  L  P  V  G  Q  P  L  P  T  P  L  L  P  Q  Y  P         p.840

          .         .         .         .         .         .       g.131721
 GTCTCTCAGATTCCCATATCAACTCCTCATGTGTCTACGGCTCAGACAGGTTTCTCATCC       c.2580
 V  S  Q  I  P  I  S  T  P  H  V  S  T  A  Q  T  G  F  S  S         p.860

          .         .         .         .         .         .       g.131781
 CTTCCCATCACAATGGCAGCTGGCATTACTCAGCCTCTGCTCACGTTGGCTTCATCTGCT       c.2640
 L  P  I  T  M  A  A  G  I  T  Q  P  L  L  T  L  A  S  S  A         p.880

          .         .         .         .         .         .       g.131841
 ACAACAGCTGCGATCCCGGGGGTATCAACTGTGGTTCCTAGTCAGCTTCCAACCCTTCTG       c.2700
 T  T  A  A  I  P  G  V  S  T  V  V  P  S  Q  L  P  T  L  L         p.900

          .         .         .         .         .         .       g.131901
 CAGCCTGTGACTCAGCTGCCAAGTCAGGTTCACCCACAGCTCCTACAACCAGCAGTTCAG       c.2760
 Q  P  V  T  Q  L  P  S  Q  V  H  P  Q  L  L  Q  P  A  V  Q         p.920

          .         .         .         .         .         .       g.131961
 TCCATGGGAATACCAGCTAACCTTGGACAAGCTGCTGAGGTTCCACTTTCCTCTGGAGAT       c.2820
 S  M  G  I  P  A  N  L  G  Q  A  A  E  V  P  L  S  S  G  D         p.940

          .   | 12     .         .         .         .         .    g.132710
 GTTCTGTACCAG | GGCTTCCCACCTCGACTGCCACCACAGTACCCAGGAGATTCAAATATT    c.2880
 V  L  Y  Q   | G  F  P  P  R  L  P  P  Q  Y  P  G  D  S  N  I      p.960

          .         .         .         .         .         .       g.132770
 GCTCCCTCTTCCAACGTGGCTTCTGTTTGCATCCATTCTACAGTCCTATCCCCTCCCATG       c.2940
 A  P  S  S  N  V  A  S  V  C  I  H  S  T  V  L  S  P  P  M         p.980

          .         .         .         .         .         .       g.132830
 CCGACAGAAGTACTGGCTACACCTGGGTACTTTCCCACAGTGGTGCAGCCTTATGTGGAA       c.3000
 P  T  E  V  L  A  T  P  G  Y  F  P  T  V  V  Q  P  Y  V  E         p.1000

          .         .         .         .         .         .       g.132890
 TCAAATCTTTTAGTTCCTATGGGTGGTGTAGGAGGACAGGTTCAAGTGTCCCAGCCAGGA       c.3060
 S  N  L  L  V  P  M  G  G  V  G  G  Q  V  Q  V  S  Q  P  G         p.1020

          .         .         .         .         .  | 13      .    g.133642
 GGGAGTTTAGCACAAGCCCCCACTACATCCTCCCAGCAAGCAGTTTTGGAG | AGTACTCAG    c.3120
 G  S  L  A  Q  A  P  T  T  S  S  Q  Q  A  V  L  E   | S  T  Q      p.1040

          .         .         .         .         .         .       g.133702
 GGAGTCTCTCAGGTTGCTCCTGCAGAGCCAGTTGCAGTAGCACAGACCCAAGCTACCCAG       c.3180
 G  V  S  Q  V  A  P  A  E  P  V  A  V  A  Q  T  Q  A  T  Q         p.1060

          .         .          | 14        .         .         .    g.133883
 CCGACCACTTTGGCTTCCTCTGTAGACAG | TGCACATTCAGATGTTGCTTCAGGTATGAGT    c.3240
 P  T  T  L  A  S  S  V  D  S  |  A  H  S  D  V  A  S  G  M  S      p.1080

          .         .         .         .         .         .       g.133943
 GATGGCAATGAGAACGTCCCATCTTCCAGTGGAAGGCATGAAGGAAGAACTACAAAACGG       c.3300
 D  G  N  E  N  V  P  S  S  S  G  R  H  E  G  R  T  T  K  R         p.1100

          .         .         .         .         .         .       g.134003
 CATTACCGAAAATCTGTAAGGAGTCGCTCTCGACATGAAAAAACTTCACGCCCAAAATTA       c.3360
 H  Y  R  K  S  V  R  S  R  S  R  H  E  K  T  S  R  P  K  L         p.1120

          .   | 15     .         .         .         .         .    g.134932
 AGAATTTTGAAT | GTTTCAAATAAAGGAGACCGAGTAGTAGAATGTCAATTAGAGACTCAT    c.3420
 R  I  L  N   | V  S  N  K  G  D  R  V  V  E  C  Q  L  E  T  H      p.1140

          .         .         .         .         .         .       g.134992
 AATAGGAAAATGGTTACATTCAAATTTGACCTAGATGGTGACAACCCCGAGGAGATAGCA       c.3480
 N  R  K  M  V  T  F  K  F  D  L  D  G  D  N  P  E  E  I  A         p.1160

           | 16        .         .         .         .         .    g.135387
 ACAATTATG | GTGAACAATGACTTTATTCTAGCAATAGAGAGAGAGTCGTTTGTGGATCAA    c.3540
 T  I  M   | V  N  N  D  F  I  L  A  I  E  R  E  S  F  V  D  Q      p.1180

          .         .         .         .         .         .       g.135447
 GTGCGAGAAATTATTGAAAAAGCTGATGAAATGCTCAGTGAGGATGTCAGTGTGGAACCA       c.3600
 V  R  E  I  I  E  K  A  D  E  M  L  S  E  D  V  S  V  E  P         p.1200

          .         .         .         .         .         .       g.135507
 GAGGGTGATCAGGGATTGGAGAGTCTACAAGGAAAGGATGACTATGGCTTTTCAGGTTCT       c.3660
 E  G  D  Q  G  L  E  S  L  Q  G  K  D  D  Y  G  F  S  G  S         p.1220

     | 17    .         .         .         .         .         .    g.135772
 CAG | AAATTGGAAGGAGAGTTCAAACAACCAATTCCTGCGTCTTCCATGCCACAGCAAATA    c.3720
 Q   | K  L  E  G  E  F  K  Q  P  I  P  A  S  S  M  P  Q  Q  I      p.1240

   | 18      .         .         .         .         .         .    g.136121
 G | GCATTCCTACCAGTTCTTTAACTCAAGTTGTTCATTCTGCGGGAAGGCGGTTTATAGTG    c.3780
 G |   I  P  T  S  S  L  T  Q  V  V  H  S  A  G  R  R  F  I  V      p.1260

          .         .         .         .         .         .       g.136181
 AGTCCTGTGCCAGAAAGCCGATTACGAGAATCAAAAGTTTTCCCCAGTGAAATAACAGAT       c.3840
 S  P  V  P  E  S  R  L  R  E  S  K  V  F  P  S  E  I  T  D         p.1280

      | 19   .         .         .         .         .         .    g.136646
 ACAG | TTGCTGCCTCTACAGCTCAGAGCCCTGGAATGAACTTGTCTCACTCTGCATCATCC    c.3900
 T  V |   A  A  S  T  A  Q  S  P  G  M  N  L  S  H  S  A  S  S      p.1300

          .         .         .         .         .         .       g.136706
 CTTAGTCTACAACAGGCCTTTTCTGAACTTAGACGTGCCCAAATGACAGAAGGACCCAAC       c.3960
 L  S  L  Q  Q  A  F  S  E  L  R  R  A  Q  M  T  E  G  P  N         p.1320

          .         .         .         .         .         .       g.136766
 ACAGCACCTCCAAACTTTAGTCATACAGGACCAACATTTCCAGTAGTACCTCCTTTCTTA       c.4020
 T  A  P  P  N  F  S  H  T  G  P  T  F  P  V  V  P  P  F  L         p.1340

          .         .         .         .         .         .       g.136826
 AGTAGCATTGCTGGAGTCCCAACCACAGCAGCAGCCACAGCACCAGTCCCTGCAACAAGC       c.4080
 S  S  I  A  G  V  P  T  T  A  A  A  T  A  P  V  P  A  T  S         p.1360

          .         .         .         .         .         .       g.136886
 AGCCCTCCTAATGACATTTCCACATCAGTAATTCAGTCTGAGGTTACAGTGCCCACTGAA       c.4140
 S  P  P  N  D  I  S  T  S  V  I  Q  S  E  V  T  V  P  T  E         p.1380

          .         .         .         .         .         .       g.136946
 GAGGGGATTGCTGGAGTTGCCACCAGCACAGGTGTGGTAACTTCAGGTGGTCTCCCCATA       c.4200
 E  G  I  A  G  V  A  T  S  T  G  V  V  T  S  G  G  L  P  I         p.1400

          .         .         .         .         .         .       g.137006
 CCACCTGTGTCTGAATCACCAGTACTTTCCAGCGTAGTTTCAAGTATCACAATACCTGCA       c.4260
 P  P  V  S  E  S  P  V  L  S  S  V  V  S  S  I  T  I  P  A         p.1420

          .         .         .         .         .         .       g.137066
 GTTGTCTCAATATCTACTACATCCCCGTCACTTCAAGTCCCCACATCCACATCTGAGATC       c.4320
 V  V  S  I  S  T  T  S  P  S  L  Q  V  P  T  S  T  S  E  I         p.1440

          .         .         .         .         .         .       g.137126
 GTTGTTTCTAGTACAGCACTGTATCCTTCAGTAACAGTTTCAGCAACTTCAGCCTCTGCA       c.4380
 V  V  S  S  T  A  L  Y  P  S  V  T  V  S  A  T  S  A  S  A         p.1460

          .         .         .         .         .         .       g.137186
 GGGGGCAGTACTGCTACCCCAGGTCCTAAGCCTCCAGCTGTAGTATCTCAGCAGGCAGCA       c.4440
 G  G  S  T  A  T  P  G  P  K  P  P  A  V  V  S  Q  Q  A  A         p.1480

          .         .         .         .         .         .       g.137246
 GGCAGCACTACTGTGGGAGCCACATTAACATCAGTTTCTACCACCACTTCATTCCCAAGC       c.4500
 G  S  T  T  V  G  A  T  L  T  S  V  S  T  T  T  S  F  P  S         p.1500

          .         .         .         .         .         .       g.137306
 ACAGCTTCACAGCTGTGCATTCAGCTTAGCAGCAGTACTTCTACTCCTACTTTAGCTGAA       c.4560
 T  A  S  Q  L  C  I  Q  L  S  S  S  T  S  T  P  T  L  A  E         p.1520

          .         .         .         .         .         .       g.137366
 ACCGTGGTAGTTAGCGCACACTCACTAGATAAGACATCTCATAGCAGTACAACTGGATTG       c.4620
 T  V  V  V  S  A  H  S  L  D  K  T  S  H  S  S  T  T  G  L         p.1540

          .         .         .         .         .         .       g.137426
 GCTTTCTCCCTCTCTGCACCATCTTCCTCTTCCTCTCCTGGAGCAGGAGTGTCTAGTTAT       c.4680
 A  F  S  L  S  A  P  S  S  S  S  S  P  G  A  G  V  S  S  Y         p.1560

          .         .         .         .         .         .       g.137486
 ATTTCTCAGCCTGGTGGGCTGCATCCTTTGGTCATTCCATCAGTGATAGCTTCTACTCCT       c.4740
 I  S  Q  P  G  G  L  H  P  L  V  I  P  S  V  I  A  S  T  P         p.1580

          .         .         .         .         .         .       g.137546
 ATTCTTCCCCAAGCAGCAGGACCTACTTCTACACCTTTATTACCCCAAGTACCTAGTATC       c.4800
 I  L  P  Q  A  A  G  P  T  S  T  P  L  L  P  Q  V  P  S  I         p.1600

          .         .         .         .         .         .       g.137606
 CCACCCTTGGTACAGCCTGTTGCCAATGTGCCTGCTGTACAGCAGACACTAATTCATAGT       c.4860
 P  P  L  V  Q  P  V  A  N  V  P  A  V  Q  Q  T  L  I  H  S         p.1620

          .         .         .         .         .         .       g.137666
 CAGCCTCAACCAGCTTTGCTTCCCAACCAGCCCCATACTCATTGTCCTGAAGTAGATTCT       c.4920
 Q  P  Q  P  A  L  L  P  N  Q  P  H  T  H  C  P  E  V  D  S         p.1640

          .         .         .         .         .         .       g.137726
 GATACACAACCCAAAGCTCCTGGAATTGATGACATAAAGACTCTAGAAGAAAAGCTGCGG       c.4980
 D  T  Q  P  K  A  P  G  I  D  D  I  K  T  L  E  E  K  L  R         p.1660

          .         .         .         .         .         .       g.137786
 TCTCTGTTCAGTGAACACAGCTCATCTGGAGCTCAGCATGCCTCTGTCTCACTGGAGACC       c.5040
 S  L  F  S  E  H  S  S  S  G  A  Q  H  A  S  V  S  L  E  T         p.1680

          .         .         .         .         .         .       g.137846
 TCACTAGTCATAGAGAGCACTGTCACACCAGGCATCCCAACTACTGCTGTTGCACCAAGC       c.5100
 S  L  V  I  E  S  T  V  T  P  G  I  P  T  T  A  V  A  P  S         p.1700

          .         .         .         .         .         .       g.137906
 AAACTCCTGACTTCTACCACAAGTACTTGCTTACCACCAACCAATTTACCACTAGGAACA       c.5160
 K  L  L  T  S  T  T  S  T  C  L  P  P  T  N  L  P  L  G  T         p.1720

          .         .         .         .         .         .       g.137966
 GTTGCTTTGCCAGTTACACCAGTGGTCACACCTGGGCAAGTTTCTACCCCAGTCAGCACT       c.5220
 V  A  L  P  V  T  P  V  V  T  P  G  Q  V  S  T  P  V  S  T         p.1740

          .         .         .         .         .         .       g.138026
 ACTACATCAGGAGTGAAACCTGGAACTGCTCCCTCCAAGCCACCTCTAACTAAGGCTCCG       c.5280
 T  T  S  G  V  K  P  G  T  A  P  S  K  P  P  L  T  K  A  P         p.1760

  | 20       .         .         .         .         .         .    g.139222
  | GTGCTGCCAGTGGGTACTGAACTTCCAGCAGGTACTCTACCCAGCGAGCAGCTGCCACCT    c.5340
  | V  L  P  V  G  T  E  L  P  A  G  T  L  P  S  E  Q  L  P  P      p.1780

          .         .     | 21   .         .         .         .    g.141117
 TTTCCAGGACCTTCTCTAACCCAG | TCCCAGCAACCTCTAGAGGATCTTGATGCTCAATTG    c.5400
 F  P  G  P  S  L  T  Q   | S  Q  Q  P  L  E  D  L  D  A  Q  L      p.1800

          .         .         .         .         | 22         .    g.142406
 AGAAGAACACTTAGTCCAGAGATGATCACAGTGACTTCTGCGGTTGGT | CCTGTGTCCATG    c.5460
 R  R  T  L  S  P  E  M  I  T  V  T  S  A  V  G   | P  V  S  M      p.1820

          .         .         .         .          | 23        .    g.146514
 GCGGCTCCAACAGCAATCACAGAAGCAGGAACACAGCCTCAGAAGGGTG | TTTCTCAAGTC    c.5520
 A  A  P  T  A  I  T  E  A  G  T  Q  P  Q  K  G  V |   S  Q  V      p.1840

          .         .         .         .         .         .       g.146574
 AAAGAAGGCCCTGTCCTAGCAACTAGTTCAGGAGCTGGTGTTTTTAAGATGGGACGATTT       c.5580
 K  E  G  P  V  L  A  T  S  S  G  A  G  V  F  K  M  G  R  F         p.1860

     | 24    .         .         .         .         .         .    g.148069
 CAG | GTTTCTGTTGCAGCAGACGGTGCCCAGAAAGAGGGTAAAAATAAGTCAGAAGATGCA    c.5640
 Q   | V  S  V  A  A  D  G  A  Q  K  E  G  K  N  K  S  E  D  A      p.1880

          .         .         .         .         .         .       g.148129
 AAGTCTGTTCATTTTGAATCCAGCACCTCAGAGTCCTCAGTGCTATCAAGTAGTAGTCCA       c.5700
 K  S  V  H  F  E  S  S  T  S  E  S  S  V  L  S  S  S  S  P         p.1900

          .         .         .         .         .         .       g.148189
 GAGAGTACCTTGGTGAAACCAGAGCCGAATGGCATAACCATCCCTGGTATCTCTTCAGAT       c.5760
 E  S  T  L  V  K  P  E  P  N  G  I  T  I  P  G  I  S  S  D         p.1920

          .         .         .         .         .         .       g.148249
 GTGCCAGAGAGTGCCCACAAAACTACTGCCTCAGAGGCAAAGTCAGACACTGGGCAGCCT       c.5820
 V  P  E  S  A  H  K  T  T  A  S  E  A  K  S  D  T  G  Q  P         p.1940

          .         .         .         .         .         .       g.148309
 ACCAAGGTTGGACGTTTTCAGGTGACAACTACAGCAAACAAAGTGGGTCGTTTCTCTGTA       c.5880
 T  K  V  G  R  F  Q  V  T  T  T  A  N  K  V  G  R  F  S  V         p.1960

          .         .         .         .         .         .       g.148369
 TCAAAAACTGAGGACAAGATCACTGACACAAAGAAAGAAGGACCAGTGGCATCTCCTCCT       c.5940
 S  K  T  E  D  K  I  T  D  T  K  K  E  G  P  V  A  S  P  P         p.1980

          .         .         .         .         .         .       g.148429
 TTTATGGATTTGGAACAAGCTGTTCTTCCTGCTGTGATACCAAAGAAAGAGAAGCCTGAA       c.6000
 F  M  D  L  E  Q  A  V  L  P  A  V  I  P  K  K  E  K  P  E         p.2000

          .         .         .         .         .         .       g.148489
 CTGTCAGAGCCTTCACATCTAAATGGGCCGTCTTCTGACCCGGAGGCCGCTTTTTTAAGT       c.6060
 L  S  E  P  S  H  L  N  G  P  S  S  D  P  E  A  A  F  L  S         p.2020

          .         .         .         .         .         .       g.148549
 AGGGATGTGGATGATGGTTCCGGTAGTCCACACTCGCCCCATCAGCTGAGCTCAAAGAGC       c.6120
 R  D  V  D  D  G  S  G  S  P  H  S  P  H  Q  L  S  S  K  S         p.2040

          .         .         .         .         .         .       g.148609
 CTTCCTAGCCAGAATCTAAGTCAAAGCCTTAGTAATTCATTTAACTCCTCTTACATGAGT       c.6180
 L  P  S  Q  N  L  S  Q  S  L  S  N  S  F  N  S  S  Y  M  S         p.2060

          .         .         .         .         .         .       g.148669
 AGCGACAATGAGTCAGATATCGAAGATGAAGACTTAAAGTTAGAGCTGCGACGACTACGA       c.6240
 S  D  N  E  S  D  I  E  D  E  D  L  K  L  E  L  R  R  L  R         p.2080

       | 25  .         .         .         .         .         .    g.149475
 GATAA | ACATCTCAAAGAGATTCAGGACCTGCAGAGTCGCCAGAAGCATGAAATTGAATCT    c.6300
 D  K  |  H  L  K  E  I  Q  D  L  Q  S  R  Q  K  H  E  I  E  S      p.2100

          .         .         .         .         .         .       g.149535
 TTGTATACCAAACTGGGCAAGGTGCCCCCTGCTGTTATTATTCCCCCAGCTGCTCCCCTT       c.6360
 L  Y  T  K  L  G  K  V  P  P  A  V  I  I  P  P  A  A  P  L         p.2120

          .         .         .         .         .         .       g.149595
 TCAGGGAGAAGACGACGACCCACTAAAAGCAAAGGCAGCAAATCTAGTCGAAGCAGTTCC       c.6420
 S  G  R  R  R  R  P  T  K  S  K  G  S  K  S  S  R  S  S  S         p.2140

          .         .         | 26         .         .         .    g.152449
 TTGGGGAATAAAAGCCCCCAGCTTTCAG | GTAACCTGTCTGGTCAGAGTGCAGCTTCAGTC    c.6480
 L  G  N  K  S  P  Q  L  S  G |   N  L  S  G  Q  S  A  A  S  V      p.2160

          .         .         .         .         .         .       g.152509
 TTGCACCCCCAGCAGACCCTCCACCCTCCTGGCAACATCCCAGAGTCCGGGCAGAATCAG       c.6540
 L  H  P  Q  Q  T  L  H  P  P  G  N  I  P  E  S  G  Q  N  Q         p.2180

          .         .         .         .         .         .       g.152569
 CTGTTACAGCCCCTTAAGCCATCTCCCTCCAGTGACAACCTCTATTCAGCCTTCACCAGT       c.6600
 L  L  Q  P  L  K  P  S  P  S  S  D  N  L  Y  S  A  F  T  S         p.2200

          .         .         .         .    | 27    .         .    g.159805
 GATGGTGCCATTTCAGTACCAAGCCTTTCTGCTCCAGGTCAAG | GAACCAGCAGCACAAAC    c.6660
 D  G  A  I  S  V  P  S  L  S  A  P  G  Q  G |   T  S  S  T  N      p.2220

          .         .         .         .         .         .       g.159865
 ACTGTTGGGGCAACAGTGAACAGCCAAGCCGCCCAAGCTCAGCCTCCTGCCATGACGTCC       c.6720
 T  V  G  A  T  V  N  S  Q  A  A  Q  A  Q  P  P  A  M  T  S         p.2240

          .         .         .         .         .         .       g.159925
 AGCAGGAAGGGCACATTCACAGATGACTTGCACAAGTTGGTAGACAATTGGGCCCGAGAT       c.6780
 S  R  K  G  T  F  T  D  D  L  H  K  L  V  D  N  W  A  R  D         p.2260

          .         .         .         .         .  | 28      .    g.160425
 GCCATGAATCTCTCAGGCAGGAGAGGAAGCAAAGGGCACATGAATTACGAG | GGCCCTGGA    c.6840
 A  M  N  L  S  G  R  R  G  S  K  G  H  M  N  Y  E   | G  P  G      p.2280

          .         .         .         .         .         .       g.160485
 ATGGCAAGGAAGTTCTCTGCACCTGGGCAACTGTGCATCTCCATGACCTCGAACCTGGGT       c.6900
 M  A  R  K  F  S  A  P  G  Q  L  C  I  S  M  T  S  N  L  G         p.2300

          .         .         .         .         .         .       g.160545
 GGCTCTGCCCCCATCTCTGCAGCATCAGCTACCTCTCTAGGTCACTTCACCAAGTCTATG       c.6960
 G  S  A  P  I  S  A  A  S  A  T  S  L  G  H  F  T  K  S  M         p.2320

          .         .         .         .         .         .       g.160605
 TGCCCCCCACAGCAGTATGGCTTTCCAGCTACCCCATTTGGCGCTCAATGGAGTGGGACG       c.7020
 C  P  P  Q  Q  Y  G  F  P  A  T  P  F  G  A  Q  W  S  G  T         p.2340

          .         .         .         .         .         .       g.160665
 GGTGGCCCAGCACCACAGCCACTTGGCCAGTTCCAACCTGTGGGAACTGCCTCCTTGCAG       c.7080
 G  G  P  A  P  Q  P  L  G  Q  F  Q  P  V  G  T  A  S  L  Q         p.2360

          .         .         .         .         .         .       g.160725
 AATTTCAACATCAGCAATTTGCAGAAATCCATCAGCAACCCCCCAGGCTCCAACCTGCGG       c.7140
 N  F  N  I  S  N  L  Q  K  S  I  S  N  P  P  G  S  N  L  R         p.2380

                                                                    g.160734
 ACCACTTAG                                                          c.7149
 T  T  X                                                            p.2382

          .         .         .         .         .         .       g.160794
 acctagagacattaactgaatagatctgggggcaggagatggaatgctgagggggtgggt       c.*60

          .         .         .         .         .         .       g.160854
 gggggtgggaagtagcctatatactaactactagtgctgcatttaactggttatttcttg       c.*120

          .         .         .         .         .         .       g.160914
 ccagaggggaatgtttttaatactgcattgagccctcagaatggagagtctcccccgctc       c.*180

          .         .         .         .         .         .       g.160974
 cagttattggaatgggagaggaaggaaagaacagcttttttgtcaaggggcagcttcaga       c.*240

          .         .         .         .         .         .       g.161034
 ccatgctttcctgtttatctatactcagtaatgaggatgagggctaggaaagtcttgttc       c.*300

          .         .         .         .         .         .       g.161094
 ataaggaagctggagaactcaatgtaaaatcaaacccatctgtaatttcgagtgggtgga       c.*360

          .         .         .         .         .         .       g.161154
 gctcttgcttttggtacatgccctgaatccctcactccctcaagaatccgaaccacagga       c.*420

          .         .         .         .         .         .       g.161214
 caaaaaccacctactgggctctctcctaccctgccctcctcccttttttttacccctctc       c.*480

          .         .         .         .         .         .       g.161274
 ttttttattttttctttgctctttagaacccagtgaaaaataccagggtactggggtgca       c.*540

          .         .         .         .         .         .       g.161334
 actctttcttatgataggtcattagtgctttaagcaaaagatattagcagctttgactgc       c.*600

          .         .         .         .         .         .       g.161394
 agcattagcaattaggaaaaaaaaaaaattaagttccctgcggacatgtaactttgccat       c.*660

          .         .         .         .         .         .       g.161454
 cagttttgatgtggaaacactgtgatatataaaatgttgttggacaacagtagttttaag       c.*720

          .         .         .         .         .         .       g.161514
 agtaaaatatgaaacgtttaaaaagttccaaaaaaagctagctctgtcctttacttattg       c.*780

          .         .         .         .         .         .       g.161574
 agacactttaactttttcctttgtatttccattgtattagataaataaatgtgaatgtaa       c.*840

          .         .         .         .         .         .       g.161634
 aattgtataaattactgtacttgaatacttctgtttcccagtgttgcttgctggacattt       c.*900

          .         .         .         .         .         .       g.161694
 tagtgccttggacttctattgcttctgccattagcatcaacttaccagaccccagatcaa       c.*960

          .         .         .         .         .         .       g.161754
 taaagggcatgtggaaggaaatcgtaggtccatgtgaccccagcagtccagcagtggtta       c.*1020

          .         .         .         .         .         .       g.161814
 tgccaaagggaaattgaaaaagtatttttttaagtcattcaacaactttgtctagagcag       c.*1080

          .         .         .         .         .         .       g.161874
 gtgtaagatgagtagggtgggaagttaggttggcatcagtggttaaaaacagaaagttct       c.*1140

          .         .         .         .         .         .       g.161934
 gtttcgggaatagtgaggagggggtgttgtaacaaaattggacaacttaaaagaatggtg       c.*1200

          .         .         .         .         .         .       g.161994
 tgtgctgggtgaaagacaaagactaaagaatgaggaaacaaacgtgatgcctggccagtg       c.*1260

          .         .         .         .         .         .       g.162054
 actgtcatataaacctttcttatttgagctaggcttgaacagacgtgacctagaagaaac       c.*1320

          .         .         .         .         .         .       g.162114
 tgaacataaagagaagggggtggggggctagttttcaagttggggaacctgatagtgaaa       c.*1380

          .         .         .         .         .         .       g.162174
 agtcacagatggagaaaattgctctcagaaaaactgtttggattgctttcctcttgttgc       c.*1440

          .         .         .         .         .         .       g.162234
 acatgtaccatgcatttctcagcttggggtactacattttgtggaaagttaatctatcta       c.*1500

          .         .         .         .         .         .       g.162294
 tctttccacatctgaattaatcattctaggaaagaatacttattcctactcatttccttt       c.*1560

          .         .         .         .         .         .       g.162354
 atgatgtccaaatggttgcaggatcataatctattgtgccacctttatttctagaagtac       c.*1620

          .         .         .         .         .         .       g.162414
 aactaatatgttcacattttcaaataaataatactccccgtaagtaataactgcaaccaa       c.*1680

          .         .         .         .         .         .       g.162474
 tcagtgttattcagtgctatgcctccttgtaatgggtagttattaattattttcagagct       c.*1740

          .         .         .         .         .         .       g.162534
 ttccggaaatactgtcctaactggctatgtttaggatctttgttatctctgaagacaaag       c.*1800

          .         .         .         .         .         .       g.162594
 aaagaagctaggactcttaattttggggtgcttcttgactcttagttgggaaactgaaaa       c.*1860

          .         .         .         .         .         .       g.162654
 tatttccaaccttttacccacgtcaatggcatattctgggaatcaccaccaccaccacca       c.*1920

          .         .         .         .         .         .       g.162714
 ctaccacagaaagaggctggaggctcctgtaccctgttcattccttaagggccctgcttc       c.*1980

          .         .         .         .         .         .       g.162774
 ccttagtaagtaagtaagttggtctacggccctaaatatgcaaatgagagctgaaggttt       c.*2040

          .         .         .         .         .         .       g.162834
 ttaaaaggtagaaaggaaaagggcaagggcttccacccctgctttaaaatgatttattta       c.*2100

          .         .         .         .         .         .       g.162894
 ttctctgcttgtatttcttgtggagagagtaaggatagaaccaacaaggggctgagtagc       c.*2160

          .         .         .         .         .         .       g.162954
 tgagaaaggggccacccaagagtgaaacatactttataccagaggagcagtggagcctca       c.*2220

          .         .         .         .         .         .       g.163014
 tgcagcacattatcatttgttatttgggtttaataataattttgacatcttttcactcat       c.*2280

          .         .         .         .         .         .       g.163074
 acacaaaaaaagtcagaactggtgttatttactgttgatttcatcctcctgtgtatgaaa       c.*2340

          .         .         .         .         .         .       g.163134
 taacaagcctagaggaatgaactagtgctactgaactgtttaaattatttttgtgttaat       c.*2400

          .         .         .         .         .         .       g.163194
 agtacactttgagtatctttttccacattaaaaactttctgaattataaatgttttcctt       c.*2460

          .         .         .         .         .         .       g.163254
 acattatttaacaatgtacactgttaaaaataaaaataaaaattcaaactttgggggttt       c.*2520

          .         .         .         .         .         .       g.163314
 ctcagcagccgttaattgtacattttgcactaactctgggtgttgcgcttcttgtaagat       c.*2580

          .         .         .         .         .         .       g.163374
 tgcgctttgtgcttcagtttgttacctttgtagacttatttaatgaaaccattcaaataa       c.*2640

          .         .                                               g.163394
 accaaacttgcttttgttga                                               c.*2660

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The WNK lysine deficient protein kinase 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2019 Leiden University Medical Center