wingless-type MMTV integration site family, member 10A (WNT10A) - coding DNA reference sequence

(used for variant description)

(last modified June 18, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_025216.2 in the WNT10A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012179.1, covering WNT10A transcript NM_025216.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5043
                  acagtcacttactctacaggcagtggggcccgacacagacagc       c.-421

 .         .         .         .         .         .                g.5103
 gccgcccccgccagccagcctcgcacgccctcggaagcgcaggctcccggcgctgcgctg       c.-361

 .         .         .         .         .         .                g.5163
 gagggttccccggcaccccagcctcccgtccccagcccgctgcacctccgggcccccctt       c.-301

 .         .         .         .         .         .                g.5223
 acccttgagaggcaccgggagttgtcgcgggggggcctcgggaaattccccggacccctg       c.-241

 .         .         .         .         .         .                g.5283
 tgccaggaggtgcccggttcgcccgctcttcaccccccgccccccccgagggcggtgccc       c.-181

 .         .         .         .         .         .                g.5343
 gggggtgctgccccatggagcggggaggcgggcgccgtctgctccgggagccctgacccg       c.-121

 .         .         .         .         .         .                g.5403
 agtcggagctgtgtgtcgcagccgccccgaccccccgccgatcatgcgccggcgcccctg       c.-61

 .         .         .         .         .         .                g.5463
 gctctccagtcccactgggctgtgagccccccactcccagcccgtcagggcctgcgcgcc       c.-1

          .         .         .         .         .         .       g.5523
 ATGGGCAGCGCCCACCCTCGCCCCTGGCTGCGGCTCCGACCCCAGCCCCAGCCGCGGCCA       c.60
 M  G  S  A  H  P  R  P  W  L  R  L  R  P  Q  P  Q  P  R  P         p.20

          .         .         .         .         .    | 02    .    g.6635
 GCGCTCTGGGTGCTCCTGTTCTTCCTACTGCTGCTGGCTGCTGCCATGCCCAG | GTCAGCA    c.120
 A  L  W  V  L  L  F  F  L  L  L  L  A  A  A  M  P  R  |  S  A      p.40

          .         .         .         .         .         .       g.6695
 CCCAATGACATTCTGGACCTCCGCCTCCCCCCGGAGCCCGTGCTCAATGCCAACACAGTG       c.180
 P  N  D  I  L  D  L  R  L  P  P  E  P  V  L  N  A  N  T  V         p.60

          .         .         .         .         .         .       g.6755
 TGCCTAACATTGCCAGGCCTGAGCCGGCGGCAGATGGAGGTGTGTGTGCGTCACCCTGAT       c.240
 C  L  T  L  P  G  L  S  R  R  Q  M  E  V  C  V  R  H  P  D         p.80

          .         .         .         .         .         .       g.6815
 GTGGCTGCCTCAGCCATACAGGGCATCCAGATCGCCATCCACGAATGCCAACACCAATTC       c.300
 V  A  A  S  A  I  Q  G  I  Q  I  A  I  H  E  C  Q  H  Q  F         p.100

          .         .         .         .         .         .       g.6875
 AGGGACCAGCGCTGGAACTGCTCAAGCCTGGAGACTCGCAACAAGATCCCCTATGAGAGT       c.360
 R  D  Q  R  W  N  C  S  S  L  E  T  R  N  K  I  P  Y  E  S         p.120

          .       | 03 .         .         .         .         .    g.14495
 CCCATCTTCAGCAGAG | GTTTCCGAGAGAGCGCTTTTGCCTACGCCATCGCAGCAGCTGGC    c.420
 P  I  F  S  R  G |   F  R  E  S  A  F  A  Y  A  I  A  A  A  G      p.140

          .         .         .         .         .         .       g.14555
 GTGGTGCACGCCGTGTCCAATGCGTGTGCCCTGGGCAAACTGAAGGCCTGTGGCTGTGAT       c.480
 V  V  H  A  V  S  N  A  C  A  L  G  K  L  K  A  C  G  C  D         p.160

          .         .         .         .         .         .       g.14615
 GCGTCCCGGCGAGGGGACGAGGAGGCCTTCCGTAGGAAGCTGCACCGCTTACAACTGGAT       c.540
 A  S  R  R  G  D  E  E  A  F  R  R  K  L  H  R  L  Q  L  D         p.180

          .         .         .         .         .         .       g.14675
 GCACTGCAGCGTGGTAAGGGCCTGAGCCATGGGGTCCCGGAACACCCAGCCCTGCCCACA       c.600
 A  L  Q  R  G  K  G  L  S  H  G  V  P  E  H  P  A  L  P  T         p.200

          .         .         .         .         .         .       g.14735
 GCCAGCCCAGGCCTGCAGGACTCCTGGGAGTGGGGCGGCTGCAGCCCCGACATGGGCTTC       c.660
 A  S  P  G  L  Q  D  S  W  E  W  G  G  C  S  P  D  M  G  F         p.220

          .         .         .         .         .         .       g.14795
 GGGGAGCGCTTTTCTAAGGACTTTCTGGACTCCCGGGAGCCTCACAGAGACATCCACGCG       c.720
 G  E  R  F  S  K  D  F  L  D  S  R  E  P  H  R  D  I  H  A         p.240

          .         .         .       | 04 .         .         .    g.17265
 AGAATGAGGCTTCACAACAACCGAGTTGGGAGGCAG | GCAGTGATGGAGAACATGCGGCGG    c.780
 R  M  R  L  H  N  N  R  V  G  R  Q   | A  V  M  E  N  M  R  R      p.260

          .         .         .         .         .         .       g.17325
 AAGTGCAAGTGCCACGGCACGTCAGGCAGCTGCCAGCTCAAGACGTGCTGGCAGGTGACG       c.840
 K  C  K  C  H  G  T  S  G  S  C  Q  L  K  T  C  W  Q  V  T         p.280

          .         .         .         .         .         .       g.17385
 CCCGAGTTCCGCACCGTGGGGGCGCTGCTGCGCAGCCGCTTCCACCGCGCCACGCTCATC       c.900
 P  E  F  R  T  V  G  A  L  L  R  S  R  F  H  R  A  T  L  I         p.300

          .         .         .         .         .         .       g.17445
 CGGCCGCACAACCGCAACGGCGGCCAGCTGGAGCCGGGCCCAGCGGGGGCACCCTCGCCG       c.960
 R  P  H  N  R  N  G  G  Q  L  E  P  G  P  A  G  A  P  S  P         p.320

          .         .         .         .         .         .       g.17505
 GCTCCGGGCGCTCCCGGGCCGCGCCGACGGGCCAGCCCCGCCGACCTGGTCTACTTCGAA       c.1020
 A  P  G  A  P  G  P  R  R  R  A  S  P  A  D  L  V  Y  F  E         p.340

          .         .         .         .         .         .       g.17565
 AAGTCTCCCGACTTCTGCGAGCGCGAGCCGCGCCTGGACTCGGCGGGCACCGTGGGCCGC       c.1080
 K  S  P  D  F  C  E  R  E  P  R  L  D  S  A  G  T  V  G  R         p.360

          .         .         .         .         .         .       g.17625
 CTGTGCAACAAGAGCAGCGCCGGCTCGGATGGCTGCGGCAGCATGTGCTGCGGCCGCGGC       c.1140
 L  C  N  K  S  S  A  G  S  D  G  C  G  S  M  C  C  G  R  G         p.380

          .         .         .         .         .         .       g.17685
 CACAACATCCTGCGCCAGACGCGCAGCGAGCGCTGCCACTGCCGCTTCCACTGGTGCTGT       c.1200
 H  N  I  L  R  Q  T  R  S  E  R  C  H  C  R  F  H  W  C  C         p.400

          .         .         .         .         .                 g.17739
 TTCGTGGTCTGCGAAGAGTGCCGCATCACCGAGTGGGTCAGCGTCTGCAAGTGA             c.1254
 F  V  V  C  E  E  C  R  I  T  E  W  V  S  V  C  K  X               p.417

          .         .         .         .         .         .       g.17799
 gcggcccggggtcccctgggccctgatcgaggtcccctcctggagcctggccctctgagg       c.*60

          .         .         .         .         .         .       g.17859
 cttacggtcttggcaaggcagcatcgccttggctcttgggaagaggagattggaccacat       c.*120

          .         .         .         .         .         .       g.17919
 gatcttataggaacccctcagctctgaggtctgtgatcgccggacagtccaggcctgtct       c.*180

          .         .         .         .         .         .       g.17979
 gaaccccaccactcacttctgtgggctctaggactgactgggttcttcctccctccccga       c.*240

          .         .         .         .         .         .       g.18039
 agcccagacagttcagttgggctgggggttgctccacaccctaaaacaagcctcagccag       c.*300

          .         .         .         .         .         .       g.18099
 gcaacccgtcagtctgtctccatcctttcaccccttccctggagatgggaggtggggaat       c.*360

          .         .         .         .         .         .       g.18159
 gaatggaagctgacgggcagagagaggaggattaaaaaaaagaaatagacataactgagc       c.*420

          .         .         .         .         .         .       g.18219
 tgaagtaattccataaagggcccagacagcctcctccaccattcccttcatcattcattt       c.*480

          .         .         .         .         .         .       g.18279
 aacaaatatttattttgcactctctttgcggcactctgggggcggtggggtgcgtggggg       c.*540

          .         .         .         .         .         .       g.18339
 tggcaatgcaaggcactgaggccacagatgtgagtaagcgagacacaacacttgtcctct       c.*600

          .         .         .         .         .                 g.18397
 tggaggttacattcttgctggggggaggcatgggcaataaacaagtaaatatacaaac         c.*658

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Wingless-type MMTV integration site family, member 10A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 15
©2004-2016 Leiden University Medical Center