ybeY metallopeptidase (putative) (YBEY) - coding DNA reference sequence

(used for variant description)

(last modified February 28, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_058181.1 in the YBEY gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000021.8, covering YBEY transcript NM_058181.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5009
                                                    tggcggggc       c.-421

 .         .         .         .         .         .                g.5069
 ttccggtcgggagggtccgcccgctctcgcgtcctttgctgggtccagacaccggtacgt       c.-361

 .         .         .         .         .         .                g.5129
 ccgggcgggtttttagtctcccaagcgagagcgtcgcattcacccgcgtgggtctgcggg       c.-301

 .         .         .         .         .         .                g.5189
 cgccccagaccccagaggacccggcccccaacgcttacctgtcccctctcctgtccctcc       c.-241

 .         .         .         .         .         .                g.5249
 cccattccagccccttctctccccagccgttgcccctccccgcaccccgccgcgtccgcg       c.-181

 .         .         .         .         .         .                g.5309
 cgcctctctccgcgcgcacccccaacccgcccccttttctctgggaaccgctccttccgc       c.-121

 .         .         .         .         .         .                g.5369
 tccgcccgcctggagtccttctggccggattccgcggcatccttccatagaccctcgttg       c.-61

 .         .      | 02  .         .         .         .             g.5561
 ttgcttcctccttgtg | gttccgttgcaaacatttttaaagggctggttattcttcctgaa    c.-1

          .         .         .         .         .         .       g.5621
 ATGAGTTTGGTGATTAGAAATCTGCAGCGAGTCATCCCCATCAGGAGAGCGCCACTTCGC       c.60
 M  S  L  V  I  R  N  L  Q  R  V  I  P  I  R  R  A  P  L  R         p.20

          .         .         .         .         .         .       g.5681
 AGTAAGATCGAGATTGTAAGGAGGATTTTAGGAGTGCAGAAATTTGACCTGGGGATCATC       c.120
 S  K  I  E  I  V  R  R  I  L  G  V  Q  K  F  D  L  G  I  I         p.40

          .         .         .         .         .         .       g.5741
 TGTGTTGACAACAAGAATATTCAGCACATTAATAGAATCTACAGAGATAGAAATGTCCCA       c.180
 C  V  D  N  K  N  I  Q  H  I  N  R  I  Y  R  D  R  N  V  P         p.60

          .         .         . | 03       .         .         .    g.10011
 ACCGATGTGCTTTCTTTTCCATTTCATGAG | CATCTGAAAGCAGGTGAATTTCCCCAGCCT    c.240
 T  D  V  L  S  F  P  F  H  E   | H  L  K  A  G  E  F  P  Q  P      p.80

          .         .         .         .         .         .       g.10071
 GATTTTCCAGATGACTACAATTTGGGAGACATTTTCCTAGGAGTGGAGTATATCTTCCAT       c.300
 D  F  P  D  D  Y  N  L  G  D  I  F  L  G  V  E  Y  I  F  H         p.100

          .         .         .          | 04        .         .    g.14830
 CAGTGTAAAGAAAATGAAGATTACAATGACGTCCTGACT | GTGACGGCCACCCACGGACTC    c.360
 Q  C  K  E  N  E  D  Y  N  D  V  L  T   | V  T  A  T  H  G  L      p.120

          .         .         .         .         | 05         .    g.16198
 TGTCACTTGCTGGGATTCACACACGGCACGGAGGCAGAGTGGCAGCAG | ATGTTCCAGAAG    c.420
 C  H  L  L  G  F  T  H  G  T  E  A  E  W  Q  Q   | M  F  Q  K      p.140

          .         .         .         .         .         .       g.16258
 GAGAAGGCGGTGCTGGACGAGCTGGGCCGACGCACGGGGACCCGGCTGCAGCCCCTGACC       c.480
 E  K  A  V  L  D  E  L  G  R  R  T  G  T  R  L  Q  P  L  T         p.160

          .         .                                               g.16282
 CGGGGCCTCTTCGGAGGGAGCTGA                                           c.504
 R  G  L  F  G  G  S  X                                             p.167

          .         .         .         .         .         .       g.16342
 gggccgcgttccttctgaaagcgggacgcgggaggggtggaggctgcggggagccggggt       c.*60

          .         .         .         .         .                 g.16399
 cgcacacgaataaataacgaatgaacgtacgaggggaacctcctcttatttccttca          c.*117

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The YbeY metallopeptidase (putative) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.