zinc finger RNA binding protein 2 (ZFR2) - coding DNA reference sequence

(used for variant description)

(last modified December 28, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_015174.1 in the ZFR2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering ZFR2 transcript NM_015174.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5012
                                                 gaagacgccaag       c.-1

          .         .         .         .         .    | 02    .    g.39053
 ATGGCGACGAGTCAGTATTTCGACTTCGCGCAGGGCGGCGGCCCGCAGTACAG | CGCCCAG    c.60
 M  A  T  S  Q  Y  F  D  F  A  Q  G  G  G  P  Q  Y  S  |  A  Q      p.20

          .         .         .         .         .         .       g.39113
 CCTCCGACCCTTCCCCTGCCCACTGTGGGGGCCAGCTATACTGCACAACCCACTCCTGGG       c.120
 P  P  T  L  P  L  P  T  V  G  A  S  Y  T  A  Q  P  T  P  G         p.40

          .         .         .         .         .         .       g.39173
 ATGGACCCTGCCGTGAACCCGGCCTTTCCCCCAGCTGCCCCGGCAGGGTACGGTGGATAC       c.180
 M  D  P  A  V  N  P  A  F  P  P  A  A  P  A  G  Y  G  G  Y         p.60

          .         .         .         .         .         .       g.39233
 CAGCCCCACTCCGGCCAGGACTTCGCCTACGGCAGCCGACCCCAGGAGCCCGTCCCCACG       c.240
 Q  P  H  S  G  Q  D  F  A  Y  G  S  R  P  Q  E  P  V  P  T         p.80

          .         .     | 03   .         .         .         .    g.40287
 GCCACCACCATGGCTACCTACCAG | GACAGTTACAGCTACGGACAGTCAGCAGCTGCCAGG    c.300
 A  T  T  M  A  T  Y  Q   | D  S  Y  S  Y  G  Q  S  A  A  A  R      p.100

          .         .         .         .         .         .       g.40347
 AGCTATGAGGACAGGCCGTACTTCCAGTCTGCTGCCCTCCAGTCTGGGCGCATGACAGCC       c.360
 S  Y  E  D  R  P  Y  F  Q  S  A  A  L  Q  S  G  R  M  T  A         p.120

          .          | 04        .         .         .         .    g.42192
 GCAGACTCCGGCCAGCCAG | GGACCCAAGAAGCCTGCGGGCAGCCCAGCCCCCATGGCAGT    c.420
 A  D  S  G  Q  P  G |   T  Q  E  A  C  G  Q  P  S  P  H  G  S      p.140

          .         .         .         .         .         .       g.42252
 CACAGCCACGCTCAGCCCCCACAGCAGGCGCCCATAGTGGAGTCCGGACAGCCAGCGAGC       c.480
 H  S  H  A  Q  P  P  Q  Q  A  P  I  V  E  S  G  Q  P  A  S         p.160

          .         .         .         .         .         .       g.42312
 ACCTTGTCCTCGGGATACACCTACCCCACGGCGACAGGCGTCCAGCCCGAGTCGTCAGCT       c.540
 T  L  S  S  G  Y  T  Y  P  T  A  T  G  V  Q  P  E  S  S  A         p.180

          .         .         .         .         .         | 05    g.42475
 TCCATCGTGACCTCCTACCCCCCGCCCTCCTACAACCCCACCTGCACCGCCTACACGG | CA    c.600
 S  I  V  T  S  Y  P  P  P  S  Y  N  P  T  C  T  A  Y  T  A |       p.200

          .         .         .         .         .         .       g.42535
 CCAAGCTACCCGAACTATGACGCGTCGGTGTACTCCGCTGCCAGCCCTTTCTATCCTCCA       c.660
 P  S  Y  P  N  Y  D  A  S  V  Y  S  A  A  S  P  F  Y  P  P         p.220

          .         .         .         .         .         .       g.42595
 GCGCAGCCCCCGCCTCCCCCGGGACCCCCGCAGCAGCTGCCCCCGCCGCCCGCGCCTGCA       c.720
 A  Q  P  P  P  P  P  G  P  P  Q  Q  L  P  P  P  P  A  P  A         p.240

          .         .         .         .         .         .       g.42655
 GGCTCAGGAAGCAGCCCCAGGGCCGACTCGAAGCCACCGCTTCCCAGCAAGCTGCCGAGA       c.780
 G  S  G  S  S  P  R  A  D  S  K  P  P  L  P  S  K  L  P  R         p.260

          .         .         .         .         .         .       g.42715
 CCCAAGGCGGGGCCCAGGCAGCTCCAGCTTCACTACTGCGACATCTGCAAGATCAGCTGC       c.840
 P  K  A  G  P  R  Q  L  Q  L  H  Y  C  D  I  C  K  I  S  C         p.280

          .   | 06     .         .         .         .         .    g.46424
 GCTGGCCCCCAG | ACCTACCGGGAACATCTGGGAGGGCAGAAGCACAGAAAGAAGGAGGCG    c.900
 A  G  P  Q   | T  Y  R  E  H  L  G  G  Q  K  H  R  K  K  E  A      p.300

          .         .         .         .         .         .       g.46484
 GCCCAGAAGACAGGCGTGCAGCCCAACGGGAGCCCGCGCGGGGTGCAGGCGCAGCTGCAT       c.960
 A  Q  K  T  G  V  Q  P  N  G  S  P  R  G  V  Q  A  Q  L  H         p.320

          .         .         .         .         .         .       g.46544
 TGCGACCTGTGCGCCGTGTCCTGCACCGGGGCGGACGCCTACGCGGCCCACATCCGGGGA       c.1020
 C  D  L  C  A  V  S  C  T  G  A  D  A  Y  A  A  H  I  R  G         p.340

          .      | 07  .         .         .         .         .    g.48667
 TCCAAGCACCAGAAG | GTCTTCAAGCTGCACGCCAAACTGGGGAAGCCCATTCCCACCCTC    c.1080
 S  K  H  Q  K   | V  F  K  L  H  A  K  L  G  K  P  I  P  T  L      p.360

          .         .         .         .         .         .       g.48727
 GAGCCTGCACTGGCCACAGAGAGCCCCCCCGGGGCAGAGGCCAAGCCCACGTCCCCCACT       c.1140
 E  P  A  L  A  T  E  S  P  P  G  A  E  A  K  P  T  S  P  T         p.380

          .         .         .         .         .         .       g.48787
 GGCCCCAGCGTGTGTGCCTCGAGCAGGCCAGCGCTGGCCAAGAGACCCGTGGCCTCGAAG       c.1200
 G  P  S  V  C  A  S  S  R  P  A  L  A  K  R  P  V  A  S  K         p.400

          .    | 08    .         .         .         .         .    g.50673
 GCCTTATGCGAGG | GGCCTCCTGAGCCACAGGCAGCAGGCTGCAGACCCCAGTGGGGGAAA    c.1260
 A  L  C  E  G |   P  P  E  P  Q  A  A  G  C  R  P  Q  W  G  K      p.420

          .         .         .         .         .         .       g.50733
 CCAGCCCAACCTAAATTAGAGGGTCCCGGAGCACCTACCCAAGGAGGCTCAAAGGAAGCT       c.1320
 P  A  Q  P  K  L  E  G  P  G  A  P  T  Q  G  G  S  K  E  A         p.440

          .         .         .         .         .  | 09      .    g.51838
 CCCGCGGGCTGCTCTGATGCGCAGCCGGTGGGCCCGGAATATGTGGAGGAG | GTGTTCAGC    c.1380
 P  A  G  C  S  D  A  Q  P  V  G  P  E  Y  V  E  E   | V  F  S      p.460

          .         .         .         .         .         .       g.51898
 GACGAAGGGCGAGTGCTTCGCTTCCACTGCAAGCTGTGCGAGTGCAGTTTCAACGACCTT       c.1440
 D  E  G  R  V  L  R  F  H  C  K  L  C  E  C  S  F  N  D  L         p.480

          .         .         .         .         .  | 10      .    g.52559
 AACGCGAAGGACCTGCACGTGAGGGGGCGGCGGCACCGGCTGCAGTACCGG | AAGAAAGTG    c.1500
 N  A  K  D  L  H  V  R  G  R  R  H  R  L  Q  Y  R   | K  K  V      p.500

          .         .         .         .         .         .       g.52619
 AACCCGGACCTTCCCATTGCCACGGAGCCCAGCAGCCGGGCTCGGAAGGTCCTGGAGGAG       c.1560
 N  P  D  L  P  I  A  T  E  P  S  S  R  A  R  K  V  L  E  E         p.520

          .         .         .         .         .         .       g.52679
 CGCATGAGGAAGCAGCGGCACCTGGCGGAGGAGCGGCTGGAGCAGCTGCGGCGCTGGCAC       c.1620
 R  M  R  K  Q  R  H  L  A  E  E  R  L  E  Q  L  R  R  W  H         p.540

          .  | 11      .         .         .         .         .    g.53788
 GCGGAGAGGAG | GCGGCTGGAGGAGGAGCCACCCCAGGACGTGCCGCCCCACGCGCCGCCC    c.1680
 A  E  R  R  |  R  L  E  E  E  P  P  Q  D  V  P  P  H  A  P  P      p.560

          .         .         .         .         .         .       g.53848
 GACTGGGCCCAGCCTCTGCTCATGGGCAGGCCGGAGTCACCCGCCAGCGCCCCACTCCAG       c.1740
 D  W  A  Q  P  L  L  M  G  R  P  E  S  P  A  S  A  P  L  Q         p.580

  | 12       .         .         .         .         .         .    g.54854
  | CCCGGGCGGCGGCCGGCGTCCAGCGACGACCGGCACGTCATGTGCAAGCACGCCACCATC    c.1800
  | P  G  R  R  P  A  S  S  D  D  R  H  V  M  C  K  H  A  T  I      p.600

          .         .         .         .         .         .       g.54914
 TACCCCACGGAGCAGGAGCTCCTGGCCGTGCAGAGGGCCGTGTCCCACGCAGAGCGGGCC       c.1860
 Y  P  T  E  Q  E  L  L  A  V  Q  R  A  V  S  H  A  E  R  A         p.620

          .         .         .         .         .         .       g.54974
 CTCAAGCTGGTGTCCGACACACTGGCCGAGGAGGACCGGGGCCGCCGAGAGGAAGAGGGT       c.1920
 L  K  L  V  S  D  T  L  A  E  E  D  R  G  R  R  E  E  E  G         p.640

          .  | 13      .         .         .         .         .    g.57233
 GACAAGCGCAG | CAGCGTTGCCCCCCAGACTCGGGTCCTGAAAGGCGTCATGCGAGTAGGC    c.1980
 D  K  R  S  |  S  V  A  P  Q  T  R  V  L  K  G  V  M  R  V  G      p.660

          .         .         .         .         .         .       g.57293
 ATCCTGGCGAAAGGCCTCCTCCTGCGTGGGGACAGGAACGTGCGCCTCGCTCTGCTCTGC       c.2040
 I  L  A  K  G  L  L  L  R  G  D  R  N  V  R  L  A  L  L  C         p.680

          .         .         .         .         .         .       g.57353
 TCCGAGAAGCCCACGCACAGCCTGCTGCGGAGGATCGCCCAGCAGCTGCCCCGGCAGCTC       c.2100
 S  E  K  P  T  H  S  L  L  R  R  I  A  Q  Q  L  P  R  Q  L         p.700

     | 14    .         .         .         .         .         .    g.60128
 CAG | ATGGTGACCGAGGATGAGTATGAGGTCTCCTCCGACCCTGAAGCCAACATTGTCATC    c.2160
 Q   | M  V  T  E  D  E  Y  E  V  S  S  D  P  E  A  N  I  V  I      p.720

          .         .         .         .         .         .       g.60188
 TCCTCCTGTGAGGAGCCCAGGATGCAGGTCACCATATCTGTCACCTCACCTCTGATGCGG       c.2220
 S  S  C  E  E  P  R  M  Q  V  T  I  S  V  T  S  P  L  M  R         p.740

          .         .   | 15     .         .         .         .    g.62701
 GAGGACCCCTCCACAGACCCAG | GTGTGGAGGAGCCTCAGGCTGATGCAGGTGATGTCCTG    c.2280
 E  D  P  S  T  D  P  G |   V  E  E  P  Q  A  D  A  G  D  V  L      p.760

          .         .         .         .         .        | 16.    g.63187
 AGCCCCAAGAAGTGCCTCGAGTCCCTGGCCGCCCTCCGTCATGCCAGGTGGTTTCAG | GCT    c.2340
 S  P  K  K  C  L  E  S  L  A  A  L  R  H  A  R  W  F  Q   | A      p.780

          .         .         .         .         .         .       g.63247
 CGAGCCAGCGGCCTGCAGCCATGCGTGATCGTCATCAGGGTCCTGAGGGACCTCTGCCGG       c.2400
 R  A  S  G  L  Q  P  C  V  I  V  I  R  V  L  R  D  L  C  R         p.800

          .         .         .    | 17    .         .         .    g.65073
 CGTGTGCCCACCTGGGGGGCCCTGCCAGCCTGG | GCCATGGAGCTGCTGGTGGAGAAGGCT    c.2460
 R  V  P  T  W  G  A  L  P  A  W   | A  M  E  L  L  V  E  K  A      p.820

          .         .         .         .         .         .       g.65133
 GTGAGCAGTGCGGCTGGGCCCCTGGGCCCCGGGGATGCAGTCAGGCGAGTCCTGGAGTGC       c.2520
 V  S  S  A  A  G  P  L  G  P  G  D  A  V  R  R  V  L  E  C         p.840

          .         .      | 18  .         .         .         .    g.66795
 GTGGCCACAGGGACGCTCCTGACAG | ACGGGCCCGGGCTCCAGGATCCCTGCGAGAGAGAC    c.2580
 V  A  T  G  T  L  L  T  D |   G  P  G  L  Q  D  P  C  E  R  D      p.860

          .         .         .         .         .         .       g.66855
 CAGACAGATGCCCTCGAGCCCATGACCCTCCAAGAGCGGGAAGACGTGACCGCCAGCGCC       c.2640
 Q  T  D  A  L  E  P  M  T  L  Q  E  R  E  D  V  T  A  S  A         p.880

     | 19    .         .         .         .         .         .    g.67961
 CAG | CACGCCCTGCGAATGCTGGCCTTCCGGCAGACCCACAAGGTCCTGGGCATGGATCTC    c.2700
 Q   | H  A  L  R  M  L  A  F  R  Q  T  H  K  V  L  G  M  D  L      p.900

          .         .         .         .         .         .       g.68021
 CTGCCGCCCAGACACCGGCTGGGGGCCCGCTTCCGGAAGAGGCAACGGGGACCTGGCGAG       c.2760
 L  P  P  R  H  R  L  G  A  R  F  R  K  R  Q  R  G  P  G  E         p.920

          .         .         .         .         .         .       g.68081
 GGAGAGGAGGGCGCAGGGGAGAAGAAGCGGGGCCGGCGGGGCGGAGAGGGGCTCGTGTGA       c.2820
 G  E  E  G  A  G  E  K  K  R  G  R  R  G  G  E  G  L  V  X         p.939

          .         .         .         .         .         .       g.68141
 gccgcctacctcccccacctgcgggcctttgcatccctgcactcctggacgtgtgcgcgc       c.*60

          .         .         .         .         .         .       g.68201
 cgaccaatggctgcttcatccccgacgttggacaatggtcatttccttttgagtaacgct       c.*120

          .         .         .         .         .         .       g.68261
 ctgtaggtttcctttaaaacacctgtgcttcagaccgggcactgtggctcatgcctttaa       c.*180

          .         .         .         .         .         .       g.68321
 tcccagcactttgggaggctgagttgcttgagcctgagagttcaaggccagcccagacaa       c.*240

          .         .         .         .         .         .       g.68381
 cagagtgagacccccatctctccaaaatatttttaaaaatcagcttggcatggttggtgg       c.*300

          .         .         .         .         .         .       g.68441
 ccaggcgcggtgattcacgcctgtaatcccagcactttgagaggccgaggtgggcagatc       c.*360

          .         .         .         .         .         .       g.68501
 gcctgaggtcaggagttcgagaccggcctggtcaacatggtgaaaccctgtctctagtaa       c.*420

          .         .         .         .         .         .       g.68561
 aaaacacaacaattagcctggcgtggtggtgtgcacctgtagtcccagctacttgggagg       c.*480

          .         .         .         .         .         .       g.68621
 ctgagtccggagccttgaggccaggagggcagtgagctgtgattgcaccgtgacactcca       c.*540

          .         .         .         .         .         .       g.68681
 gcctgggcaacagaagaagactttgtcacttaaaagaaatgttttttaacatttgtgctt       c.*600

          .         .         .         .         .         .       g.68741
 aaattgttacagaaatgacaccatccagccctgggagtggcaccccttcctcgagggccc       c.*660

          .         .         .         .         .         .       g.68801
 catcccccacagccaggggggccagcagtacagcaagcagattctaaactcgggggcatc       c.*720

          .         .         .         .         .         .       g.68861
 ttgctggctctaaactcacctcgtggtacaggaaggggttttaaaatacttcctctgggc       c.*780

          .         .         .         .         .         .       g.68921
 tgcgcatggtggctcacacctataatcccagcactttgggaggccaagcttggtggatcg       c.*840

          .         .         .         .         .         .       g.68981
 cttgagcccagcggtttaagatcagtctgggcaatatggtgacaccccatctctacaaaa       c.*900

          .         .         .         .         .         .       g.69041
 aattagccagttgtggtggcccaagcctgtagtcccagctactcgggaggctgaggccgt       c.*960

          .         .         .         .         .         .       g.69101
 aggatcccttgagcccaggagttcgaggctgcagcgagccgagattgcgctactgaactc       c.*1020

          .         .         .         .         .         .       g.69161
 cagcctgggttacagagcgagaccctgtctcaaagaaacaaacaaacaaacaaacaaaca       c.*1080

          .         .         .         .         .         .       g.69221
 aacaaaactttctttggatgcggctgcggcatggatttgaaatcacgtgggcaggccctg       c.*1140

          .         .         .         .         .         .       g.69281
 ttctggggccccaccacatgtgcaggacaagcccaggggagctcccagccggcatcccca       c.*1200

          .         .         .         .         .         .       g.69341
 cgcccccagcccagcctgctccaaacagaccccccacccacctccacagccaggatgtca       c.*1260

          .         .         .         .         .         .       g.69401
 gcagggcctgagccaggctcgtcccctgtggggagagccacagggccaggtggacacgcc       c.*1320

          .         .         .         .         .         .       g.69461
 gacgggcgatgaggatcctggctgggcctcccccgggaacagctgtgctggacagtcaga       c.*1380

          .         .         .         .         .         .       g.69521
 cccggagcccagaggcacccccacccaccccccgccccgagccctgtaccactgagtgcc       c.*1440

          .         .         .         .         .         .       g.69581
 tttcacagagaaaacccactctgccatgtgtcactgaggcctggatttgagcttccgtcc       c.*1500

          .         .         .         .         .         .       g.69641
 ttccttcctccctctctccctgatgtaggccttggctggccctgaggcagggggtcccca       c.*1560

          .         .         .         .         .         .       g.69701
 atccccccttgtggtagcagggcccgggacccgtgcctgggggacccggggaggggccgc       c.*1620

          .         .         .         .         .         .       g.69761
 cgtcttgtggatgctggccatggtgggcaggcgcctcctggcactgatggatgtgggggc       c.*1680

          .         .         .         .         .         .       g.69821
 acccccttctgagtccccaccccaacctgttcaaaccttccgcttggtcagttttttttt       c.*1740

          .         .         .         .         .         .       g.69881
 ctttggccagctgcccagtggcattgaatgagaaaagtccacctttgggcagatgtgatc       c.*1800

          .         .         .         .         .         .       g.69941
 tccagccagtggctcagttttgtttctctgtgtttgaaggacagcctgcatgtggctctg       c.*1860

          .         .         .         .         .         .       g.70001
 tctgaatgtctttgtagagctacctggaaattgggaggcagggggaataaaggaaatcat       c.*1920

                                                                    g.70006
 ttgtc                                                              c.*1925

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Zinc finger RNA binding protein 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center