zinc finger, MYND-type containing 19 (ZMYND19) - coding DNA reference sequence

(used for variant description)

(last modified October 16, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_138462.2 in the ZMYND19 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000009.11, covering ZMYND19 transcript NM_138462.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5042
                   gcggtggcggcggcggcggcggcgcgtggcaggtccggcggg       c.-181

 .         .         .         .         .         .                g.5102
 cgcgaggcggcggcggaggcccgagcccggcccagcctcgtcccgcccggagcccgcctg       c.-121

 .         .         .         .         .         .                g.5162
 gctgctaccccgaccccggctccggtcccgtcctgtcccggcgcgccgcggcctcgcccc       c.-61

 .         .         .         .         .         .                g.5222
 ggcccccgctcggcgcctcccgagggagcggcgctgccggccgagagcgcaggcccggcc       c.-1

          .         .         .         .         .  | 02      .    g.6776
 ATGACCGACTTCAAATTGGGTATCGTGCGGCTCGGCCGGGTGGCCGGGAAG | ACCAAATAC    c.60
 M  T  D  F  K  L  G  I  V  R  L  G  R  V  A  G  K   | T  K  Y      p.20

          .         .         .         .         .  | 03      .    g.7671
 ACGCTGATCGATGAGCAGGACATCCCGCTGGTGGAGAGCTACTCCTTTGAG | GCCCGAATG    c.120
 T  L  I  D  E  Q  D  I  P  L  V  E  S  Y  S  F  E   | A  R  M      p.40

          .         .         .         .         .         .       g.7731
 GAAGTGGATGCAGATGGAAATGGTGCTAAGATATTTGCCTATGCCTTTGACAAGAACCGA       c.180
 E  V  D  A  D  G  N  G  A  K  I  F  A  Y  A  F  D  K  N  R         p.60

          .         .         .         | 04         .         .    g.8400
 GGAAGGGGCTCTGGGAGACTCCTTCATGAGCTGCTGTG | GGAGCGGCACCGGGGGGGCGTG    c.240
 G  R  G  S  G  R  L  L  H  E  L  L  W  |  E  R  H  R  G  G  V      p.80

          .         .         .         .         .         .       g.8460
 GCCCCGGGCTTCCAGGTGGTGCACCTCAACGCTGTGACCGTGGACAATCGCCTGGACAAC       c.300
 A  P  G  F  Q  V  V  H  L  N  A  V  T  V  D  N  R  L  D  N         p.100

          .         .         .         .         .          | 05    g.12323
 CTGCAACTGGTGCCGTGGGGCTGGCGGCCCAAGGCTGAAGAGACCTCCAGCAAGCAGAG | G    c.360
 L  Q  L  V  P  W  G  W  R  P  K  A  E  E  T  S  S  K  Q  R  |      p.120

          .         .         .         .         .         .       g.12383
 GAGCAAAGCTTGTATTGGCTTGCAATTCAGCAGCTGCCTACAGACCCTATAGAAGAACAG       c.420
 E  Q  S  L  Y  W  L  A  I  Q  Q  L  P  T  D  P  I  E  E  Q         p.140

          .         .         .         .         .         .       g.12443
 TTTCCTGTCCTAAATGTGACCCGGTATTATAATGCCAACGGGGATGTAGTGGAAGAGGAG       c.480
 F  P  V  L  N  V  T  R  Y  Y  N  A  N  G  D  V  V  E  E  E         p.160

          .         .         .         .         .         .       g.12503
 GAGAACTCTTGCACCTACTATGAGTGCCACTACCCTCCCTGCACAGTGATTGAGAAGCAG       c.540
 E  N  S  C  T  Y  Y  E  C  H  Y  P  P  C  T  V  I  E  K  Q         p.180

  | 06       .         .         .         .         .         .    g.12859
  | CTCCGGGAGTTCAACATCTGTGGGCGCTGCCAGGTGGCCCGGTACTGCGGCTCCCAGTGC    c.600
  | L  R  E  F  N  I  C  G  R  C  Q  V  A  R  Y  C  G  S  Q  C      p.200

          .         .         .         .         .         .       g.12919
 CAGCAGAAGGACTGGCCTGCCCACAAGAAGCACTGTCGGGAGAGGAAGCGTCCCTTCCAG       c.660
 Q  Q  K  D  W  P  A  H  K  K  H  C  R  E  R  K  R  P  F  Q         p.220

          .         .                                               g.12943
 CATGAGCTTGAGCCAGAGCGATGA                                           c.684
 H  E  L  E  P  E  R  X                                             p.227

          .         .         .         .         .         .       g.13003
 cgggcaggggagccacacatactcacagcccccgggctctaccctgggcacagcagagac       c.*60

          .         .         .         .         .         .       g.13063
 agactggtggttgaacctggaggtgccaaaaaagccagctgcgggcccaggacagctgcc       c.*120

          .         .         .         .         .         .       g.13123
 gtgagactcccgatgtcacaggcagtctgtgtggttacagcgcccctcagtgttcatctc       c.*180

          .         .         .         .         .         .       g.13183
 cagcagagacaacggaggaggctcccaccaggacggttctcattatttatatgttaatat       c.*240

          .         .         .         .         .         .       g.13243
 gtttgtaaactcatgtacagttttttttgggggggaggcaatgggaagggtagaaattac       c.*300

          .         .         .         .         .         .       g.13303
 aaatagaatcatttgctgtaatccttaaatggcaaacggtcaggccacgtgactaaaaac       c.*360

          .         .         .         .         .         .       g.13363
 tgtcctgttgtcgaagcttctcccctgggccgccgggagccccgtggagcgcggcctgca       c.*420

          .         .         .         .                           g.13407
 cgggagttgtgtccacaaaggcaaagtaaaggggtggaatcatc                       c.*464

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Zinc finger, MYND-type containing 19 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center