zinc finger, HIT-type containing 3 (ZNHIT3) - coding DNA reference sequence

(used for variant description)

(last modified June 2, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_004773.3 in the ZNHIT3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering ZNHIT3 transcript NM_004773.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5011
                                                aggggcgtgcacg       c.-61

 .         .         .         .         .         .                g.5071
 cgggcgcggctgcgtgagaggcgcgcggcggcgcagtaaacagtctccttccacaaaacc       c.-1

          .         .         .         .         .         .       g.5131
 ATGGCGTCGCTCAAATGTAGCACCGTCGTCTGCGTGATCTGCTTGGAGAAGCCCAAATAC       c.60
 M  A  S  L  K  C  S  T  V  V  C  V  I  C  L  E  K  P  K  Y         p.20

          .         .       | 02 .         .         .         | 03 g.11186
 CGCTGTCCAGCCTGCCGCGTGCCCTA | CTGCTCGGTAGTCTGCTTCCGGAAGCACAAAG | AA c.120
 R  C  P  A  C  R  V  P  Y  |  C  S  V  V  C  F  R  K  H  K  E |    p.40

          .         .         .         .         .         .       g.11246
 CAGTGCAACCCTGAAACTCGTCCTGTTGAGAAAAAAATAAGATCAGCTCTTCCTACCAAA       c.180
 Q  C  N  P  E  T  R  P  V  E  K  K  I  R  S  A  L  P  T  K         p.60

          .         .      | 04  .         .         .         .    g.12332
 ACCGTAAAGCCTGTGGAAAACAAAG | ATGATGATGACTCTATAGCTGATTTTCTCAATAGT    c.240
 T  V  K  P  V  E  N  K  D |   D  D  D  S  I  A  D  F  L  N  S      p.80

          .         .         .         .       | 05 .         .    g.13608
 GATGAGGAAGAAGACAGAGTTTCTTTGCAGAATTTAAAGAATTTAG | GGGAATCTGCAACA    c.300
 D  E  E  E  D  R  V  S  L  Q  N  L  K  N  L  G |   E  S  A  T      p.100

          .         .         .         .         .         .       g.13668
 TTAAGAAGCTTATTGCTCAATCCACACCTCAGGCAGTTGATGGTCAACCTCGATCAGGGA       c.360
 L  R  S  L  L  L  N  P  H  L  R  Q  L  M  V  N  L  D  Q  G         p.120

          .         .         .         .         .         .       g.13728
 GAAGACAAAGCAAAGCTCATGAGAGCTTACATGCAAGAGCCTTTGTTTGTGGAGTTTGCA       c.420
 E  D  K  A  K  L  M  R  A  Y  M  Q  E  P  L  F  V  E  F  A         p.140

          .         .         .         .                           g.13776
 GACTGCTGTTTAGGAATTGTGGAGCCATCCCAGAATGAGGAGTCTTAA                   c.468
 D  C  C  L  G  I  V  E  P  S  Q  N  E  E  S  X                     p.155

          .         .         .         .         .         .       g.13836
 gatggattattgtgctgcttgctcaagcgtgtgcttgactcctggaacctgcctgctccc       c.*60

          .         .         .         .         .         .       g.13896
 tctcccagaccagctagtttggggctggggagctcaggcaaaagaggtttccaggatgca       c.*120

          .         .         .         .         .         .       g.13956
 gattaggtcatgcaggcctttaccggcattgatgtggctcatgtttcaggcagacttggg       c.*180

          .         .         .         .         .         .       g.14016
 gtccttaaggtggcaagtcctttatggagagaaaacttgacattcagatgattgttttta       c.*240

          .         .         .         .         .         .       g.14076
 aatgttttacttttggtacagttgatagacatcataaacgatatcaagcttacacttcat       c.*300

          .         .         .         .         .         .       g.14136
 atggagttaaacttggtcagtgttaataaaatcaaaacgtgattctactgtacattgcat       c.*360

          .         .         .         .         .                 g.14194
 tattcataatttaattgtttgaaattacattaaataaatcaactaattaaatactaaa         c.*418

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Zinc finger, HIT-type containing 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.