Screening #0000088209

Individual ID 00088069
Template DNA
Technique SEQ
Tissue -
Remarks -
Variants found? 1
Owner name Andreas Laner

Genes screened







Unique variants     

Last updated     

Associated with diseases
ADAMTSL4 ADAMTS-like 4 1 q21.2 1 156 82 2020-08-06 Ectopia lentis et pupillae, Ectopia lentis, isolated autosomal recessive

Variants found

1 entry on 1 page. Showing entry 1.




Classification method     

Clinical classification     

AscendingDNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     









Codon change     

IDbase Accession Number     





DNA change (cDNA)     


RNA change     
















Enzyme activity     

mRNA level     



Legacy protein change     

Protein level     
1 Unknown +/+ - pathogenic g.150526234_150526253del g.150553758_150553777del c.767_786delAGGCCTCTGGCACAGAGCCC; p.(Gln256ProfsX38) - ADAMTSL4_000001 - PubMed: Neuhann 2011 - - Germline - - - 0 - Andreas Laner ADAMTSL4 - - - - - 6 NM_019032.4:c.767_786del - r.(?) p.(Gln256Profs*38) - - - - - - - - - - - - - - - - - - - -