Screening #0000088209

Individual ID 00088069
Template DNA
Technique SEQ
Tissue -
Remarks -
Variants found? 1
Owner name Andreas Laner


Genes screened


AscendingSymbol     

Gene     

Chr     

Band

Transcripts     

Variants     

Unique variants     

Last updated     

Associated with diseases
ADAMTSL4 ADAMTS-like 4 1 q21.2 1 137 66 2019-09-30 Ectopia lentis et pupillae, Ectopia lentis, isolated autosomal recessive



Variants found

1 entry on 1 page. Showing entry 1.
Legend  

Chr     

Allele     

Effect     

AscendingDNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     

Gene     

Codon change     

IDbase Accession Number     

VariO/DNA     

VariO/Protein     

VariO/RNA     

Exon     

DNA change (cDNA)     

Haplotype     

ClassClinical     

RNA change     

Protein     

P-domain     

Exon_old     

DNA/Legacy     

Function/GVS     

Predict/AGVGD     

Predict/Grantham     

Predict/MutationTaster     

Predict/PolyPhen     

Predict/PolyPhenScore     

Predict/SIFT     

Predicted     

Type/DNA     

Conservation     

CpG     

Enzyme activity     

mRNA level     

Predict/CADD     

Predict/Splice     

Protein level     
1 Unknown +/+ g.150526234_150526253del - c.767_786delAGGCCTCTGGCACAGAGCCC; p.(Gln256ProfsX38) - ADAMTSL4_000001 - PubMed: Neuhann 2011 - - Germline - - - 0 - Andreas Laner ADAMTSL4 - - - - - 6 NM_019032.4:c.767_786del - - r.(?) p.(Gln256Profs*38) - - - - - - - - - - - - - - - - - - -
Legend