Transcript #00000246

Transcript name RNA component of mitochondrial RNA processing endoribonuclease
Gene name RMRP (RNA component of mitochondrial RNA processing endoribonuclease)
Chromosome 9
Transcript - NCBI ID NR_003051.3
Transcript - Ensembl ID -
Protein - NCBI ID -
Protein - Ensembl ID -
Protein - Uniprot ID -
Remarks -


Variants

102 entries on 2 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2     Next › Last »

Affects function     

Exon     

AscendingDNA change (cDNA)     

Class.     

RNA change     

Protein     
+?/+? - n.-25_-4dupTACTACTCTGTGAAGCTGAGGA - r.? -
+?/+? - n.-24_-18dupACTACTC - r.? -
+?/+? - n.-24_-12dup - r.? -
+?/+? - n.-24_-10dupACTACTCTGTGAAGC - r.? -
+?/+? - n.-24_-4dupACTACTCTGTGAAGCTGAGGA - r.? -
+?/+? - n.-23_-14dupCTACTCTGTG - r.? -
+?/+? - n.-22-6dupTACTCTGTGAAGCTGAG - r.? -
+?/+? - n.-22_-14dupTACTCTGTG - r.? -
+?/+? - n.-22_-13dupTACTCTGTGA - r.? -
+?/+? - n.-22_-3dupTACTCTGTGAAGCTGAGGAC - r.? -
+?/+? - n.-21_-9dupACTCTGTGAAGCT - r.? -
+/+ - n.-20_-19insTCTGTGAAGCTGGGGAC - r.0 -
+?/+? - n.-20_1dupCTCTGTGAAGCTGAGGACGTG - r.? -
+?/+? - n.-19_-13dupTCTGTGA - r.? -
+?/+? - n.-19_-3dupTCTGTGAAGCTGAGGAC - r.? -
+?/+? - n.-18_-17insCTCACTACTC - r.? -
+?/+? - n.-15_-6dupTGAAGCTGAG - r.? -
+?/+? - n.-15_1dupTGAAGCTGAGGACGTG - r.? -
+?/+? - n.-14_3dupGAAGCTGAGGACGTGGT - r.? -
+/+ - n.-13_-12insATCTGTG - r.0 -
+?/+? - n.-13_-6dupAAGCTGAG - r.? -
+?/+? - n.-13_-2dupAAGCTGAGGACG - r.? -
+?/+? - n.-13_1dupAAGCTGAGGACGTG - r.? -
+/+ - n.-10_-9insTACTCTGTGAAGTACTCTGTGAAGCTGA - r.0 -
+?/+? - n.-10_-4delCTGAGGAins28 - r.? -
+?/+? - n.-8_-1dupGAGGACGT - r.? -
+?/+? - n.-7_1dupAGGACGTG - r.? -
+/+ - n.-6_-5insCCTGAG - r.0 -
+?/+? - n.-6_4dupGGACGTGGTT - r.? -
+?/+? - n.-4_-3insGGACGTGGTT - r.? -
+?/+? - n.-3_1dupCGTG - r.? -
+?/+? - n.-20_-13CTCTGTGA[3] - r.? -
+/+ - n.-24_-10ACTACTCTGTGAAGC[3] - r.0 -
+?/+? - n.-24_-9ACTACTCTGTGAAGCT[3] - r.? -
+?/+? - n.5C>T - r.5c>u -
+?/+? - n.10T>C - r.10u>c -
?/? - n.12A>G - r.12a>g -
+?/+? - n.15G>T - r.15g>u -
+?/+? - n.19G>C - r.19g>c -
+?/+? - n.28G>A - r.28g>a -
+?/+? - n.36C>T - r.36c>u -
+?/+? - n.41G>A - r.41g>a -
+?/+? - n.46_54dupTGTTCCTCC - r.46_54dupuguuccucc -
+?/+? - n.57_58insTTCCGCCT - r.57_58insuuccgccu -
+?/+? - n.62G>A - r.62g>a -
+?/+? - n.64C>T - r.64c>u -
+?/+? - n.65T>C - r.65u>c -
+?/+? - n.69_70delinsTT - r.69_70delinsuu -
+/+ - n.71A>G - r.71a>g -
+?/+? - n.77C>T - r.77c>u -
+?/+? - n.78C>T - r.78c>u -
+?/+? - n.80G>A - r.80g>a -
+?/+? - n.81G>A - r.81g>a -
+?/+? - n.90C>G - r.90c>g -
+?/+? - n.92G>A - r.92g>a -
+?/+? - n.93dupA - r.93dupa -
+?/+? - n.94G>C - r.94g>c -
+?/+? - n.95_96delAG - r.95_96delag -
+?/+? - n.97_98dupTG - r.97_98dupug -
+?/+? - n.98G>A - r.98g>a -
+?/+? - n.102C>T - r.102c>u -
+?/+? - n.117A>G - r.117a>g -
+?/+? - n.119A>G - r.119a>g -
+?/+? - n.125C>T - r.125c>u -
+?/+? - n.127C>T - r.127c>u -
+?/+? - n.128G>A - r.128g>a -
?/? - n.128G>C - r.128g>c -
+?/+? - n.147G>A - r.147g>a -
+?/+? - n.147G>C - r.147g>c -
+?/+? - n.153A>G - r.153a>g -
+?/+? - n.155G>C - r.155g>c -
+?/+? - n.155G>T - r.155g>u -
+?/+? - n.169G>A - r.169g>a -
+?/+? - n.180_181insC - r.180_181insc -
+?/+? - n.181G>A - r.181g>a -
+?/+? - n.183G>A - r.183g>a -
+?/+? - n.183G>C - r.183g>c -
+?/+? - n.183G>T - r.183g>u -
+?/+? - n.194G>A - r.194g>a -
+?/+? - n.195dupT - r.195dupu -
+?/+? - n.196C>T - r.196c>u -
+?/+? - n.212C>G - r.212c>g -
+?/+? - n.214C>G - r.214c>g -
+?/+? - n.215A>T - r.215a>u -
+?/+? - n.218C>T - r.218c>u -
+?/+? - n.219A>G - r.219a>g -
+?/+? - n.221T>C - r.221u>c -
+?/+? - n.231C>T - r.231c>u -
+?/+? - n.237A>G - r.237a>g -
+?/+? - n.239C>T - r.239c>u -
+?/+? - n.241A>C - r.241a>c -
+?/+? - n.243A>G - r.243a>g -
+?/+? - n.244C>T - r.244c>u -
+?/+? - n.245G>A - r.245g>a -
+?/+? - n.249C>T - r.249c>u -
+?/+? - n.257_266delCAGCGCGGCT - r.257_266delcagcgcggcu -
+?/+? - n.261C>G - r.261c>g -
+?/+? - n.262C>T - r.262c>u -
+?/+? - n.263G>C - r.263g>c -
+?/+? - n.263G>T - r.263g>u -
Legend   « First ‹ Prev     1 2     Next › Last »